ID: 1165916568

View in Genome Browser
Species Human (GRCh38)
Location 19:39264588-39264610
Sequence CACACCCGTCGCTGACCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165916561_1165916568 -7 Left 1165916561 19:39264572-39264594 CCCCGCCGGGTTCCCACACACCC No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916552_1165916568 16 Left 1165916552 19:39264549-39264571 CCTTGCGCCCCCCGGTACACTGG No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916550_1165916568 21 Left 1165916550 19:39264544-39264566 CCAGCCCTTGCGCCCCCCGGTAC No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916558_1165916568 6 Left 1165916558 19:39264559-39264581 CCCGGTACACTGGCCCCGCCGGG No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916562_1165916568 -8 Left 1165916562 19:39264573-39264595 CCCGCCGGGTTCCCACACACCCG No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916560_1165916568 5 Left 1165916560 19:39264560-39264582 CCGGTACACTGGCCCCGCCGGGT No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916547_1165916568 25 Left 1165916547 19:39264540-39264562 CCGCCCAGCCCTTGCGCCCCCCG No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916563_1165916568 -9 Left 1165916563 19:39264574-39264596 CCGCCGGGTTCCCACACACCCGT No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916551_1165916568 17 Left 1165916551 19:39264548-39264570 CCCTTGCGCCCCCCGGTACACTG No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916556_1165916568 7 Left 1165916556 19:39264558-39264580 CCCCGGTACACTGGCCCCGCCGG No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916549_1165916568 22 Left 1165916549 19:39264543-39264565 CCCAGCCCTTGCGCCCCCCGGTA No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916555_1165916568 8 Left 1165916555 19:39264557-39264579 CCCCCGGTACACTGGCCCCGCCG No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data
1165916554_1165916568 9 Left 1165916554 19:39264556-39264578 CCCCCCGGTACACTGGCCCCGCC No data
Right 1165916568 19:39264588-39264610 CACACCCGTCGCTGACCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165916568 Original CRISPR CACACCCGTCGCTGACCCGA GGG Intergenic
No off target data available for this crispr