ID: 1165916850

View in Genome Browser
Species Human (GRCh38)
Location 19:39265765-39265787
Sequence GCCTGCTCACGTGGGAGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165916844_1165916850 17 Left 1165916844 19:39265725-39265747 CCTCGGTGTCGCGAAGCCAGCGT No data
Right 1165916850 19:39265765-39265787 GCCTGCTCACGTGGGAGCTCCGG No data
1165916845_1165916850 1 Left 1165916845 19:39265741-39265763 CCAGCGTGATCTTCAACCTCCTG No data
Right 1165916850 19:39265765-39265787 GCCTGCTCACGTGGGAGCTCCGG No data
1165916841_1165916850 27 Left 1165916841 19:39265715-39265737 CCAGGACTCCCCTCGGTGTCGCG No data
Right 1165916850 19:39265765-39265787 GCCTGCTCACGTGGGAGCTCCGG No data
1165916842_1165916850 19 Left 1165916842 19:39265723-39265745 CCCCTCGGTGTCGCGAAGCCAGC No data
Right 1165916850 19:39265765-39265787 GCCTGCTCACGTGGGAGCTCCGG No data
1165916843_1165916850 18 Left 1165916843 19:39265724-39265746 CCCTCGGTGTCGCGAAGCCAGCG No data
Right 1165916850 19:39265765-39265787 GCCTGCTCACGTGGGAGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165916850 Original CRISPR GCCTGCTCACGTGGGAGCTC CGG Intergenic