ID: 1165920981

View in Genome Browser
Species Human (GRCh38)
Location 19:39297817-39297839
Sequence CTGGGGAGAAGGAGACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1458
Summary {0: 1, 1: 0, 2: 13, 3: 156, 4: 1288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165920981_1165920996 27 Left 1165920981 19:39297817-39297839 CCCTCCTGTCTCCTTCTCCCCAG 0: 1
1: 0
2: 13
3: 156
4: 1288
Right 1165920996 19:39297867-39297889 CTGTGTCACCGACCTTCCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165920981 Original CRISPR CTGGGGAGAAGGAGACAGGA GGG (reversed) Intronic
900011137 1:109954-109976 CTGGGGAGACTAATACAGGAGGG - Intergenic
900027240 1:286518-286540 CTGGGGAGACTAATACAGGAGGG - Intergenic
900244611 1:1631409-1631431 AAGGGGAGAGGGAGACGGGAGGG - Intergenic
900264039 1:1748309-1748331 CTGGGGAGAGGAAGAGAGGAAGG - Intergenic
900429154 1:2593751-2593773 CCGCGGAGAAGCAGCCAGGAAGG - Intronic
900494667 1:2971050-2971072 TTGGCGAGTGGGAGACAGGAGGG + Intergenic
900573124 1:3369524-3369546 CTGGGTATGAGGAGAAAGGATGG + Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900602174 1:3507629-3507651 CTGGAGACAGGGAGGCAGGAAGG + Intronic
900621093 1:3588142-3588164 GGGGGCAGAAGGGGACAGGAGGG + Intronic
900621114 1:3588192-3588214 GGGGGCAGAAGGGGACAGGAGGG + Intronic
900621144 1:3588262-3588284 GGGGGCAGAAGGGGACAGGAGGG + Intronic
900756667 1:4440174-4440196 CTGGGGTGAAGGAAAGAGGCTGG - Intergenic
900798374 1:4723208-4723230 CTGGGGAGCAGCAGATTGGAAGG + Intronic
900824398 1:4914367-4914389 CTGGTGAGCAGGCCACAGGAAGG + Intergenic
900886026 1:5415940-5415962 CTGGGCAGAACTACACAGGAAGG + Intergenic
900969060 1:5979419-5979441 TTGGGGAGAGGGAGCCAGGCAGG + Intronic
901065537 1:6492456-6492478 TTGGGGAGATGGAGAAAGGCCGG - Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901756768 1:11446146-11446168 CTCGGGACAAGAGGACAGGAGGG - Intergenic
901862045 1:12080800-12080822 TTTGGGAGAATGAGACAGGAGGG - Intronic
901919350 1:12525401-12525423 CAGGGGAGGAGGATCCAGGAAGG + Intergenic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902269943 1:15296585-15296607 CTGGGGGGAAACAAACAGGAAGG + Intronic
902329538 1:15724575-15724597 CTGGGGAGAAGCAGCCTGGGGGG + Intronic
902702827 1:18184331-18184353 CTGGGGAGGGGGAGAAGGGAGGG - Intronic
902778194 1:18687899-18687921 GGAGGGACAAGGAGACAGGAAGG + Intronic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
903130968 1:21279333-21279355 CTGCAGGGAAGGAGGCAGGAGGG + Intronic
903202184 1:21750419-21750441 CTGTGGAGAAGAAGAAAGCAGGG - Intronic
903242425 1:21992283-21992305 CTCAGGAGGTGGAGACAGGAGGG + Intronic
903245937 1:22015468-22015490 CTCAGGAGGTGGAGACAGGAGGG + Intergenic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
903670243 1:25031156-25031178 CTGGAGAGATGGAGACTGGAGGG + Intergenic
903699726 1:25238089-25238111 CTCGGGAGGCTGAGACAGGAGGG - Intergenic
904265303 1:29315295-29315317 CTAAGGAGAAGAAGAGAGGAGGG - Intronic
904267365 1:29325576-29325598 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904446125 1:30574252-30574274 CTGGGCCAAAGGAGGCAGGAAGG - Intergenic
904519866 1:31086537-31086559 CTGGGGAGGCTGAGACAGGAAGG + Intergenic
905029251 1:34870510-34870532 CTGGAGAGAAGTAGGCAGGCAGG - Intronic
905263326 1:36734278-36734300 CTGGAGAGACCGGGACAGGAGGG - Intergenic
905336113 1:37245631-37245653 CTTGTAAGAGGGAGACAGGAGGG + Intergenic
905397439 1:37675911-37675933 CAGGGGATAAGGCCACAGGAAGG + Intergenic
905627292 1:39497674-39497696 CTGGGGAGTAGGAGAAAGAGGGG - Intronic
905653331 1:39671139-39671161 CTGGGAAGTTGGAGACAGCAAGG + Intronic
905669130 1:39779456-39779478 CTGGGGAGGAGGAGAAAGAGGGG + Intronic
905793521 1:40802619-40802641 CTGAGGAGAAGGAGCCCGGGCGG + Intronic
905809633 1:40902618-40902640 CTGAGGCGATGGTGACAGGATGG + Intergenic
905866512 1:41379779-41379801 CTGGTGGGAAGGAGGCAGGAGGG + Intronic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
906118234 1:43369389-43369411 CTCGGGAGACTGAGACAGAATGG + Intergenic
906199916 1:43953357-43953379 TTTGGGGGAAGGAGACAGGGAGG - Intronic
906224146 1:44107047-44107069 GTGGGGAGGAGGAGAGAGGTGGG + Intergenic
906622757 1:47297693-47297715 CTTGGGAGAGTGAGGCAGGAGGG - Intronic
906722730 1:48020992-48021014 GTGGGGTGAAGGAGACAGGCAGG + Intergenic
906732778 1:48097591-48097613 CTGAGGAGAAGCAGATTGGAGGG - Intergenic
906805534 1:48776478-48776500 GACGGGAGAAGGAGGCAGGAAGG + Intronic
906942016 1:50263834-50263856 GTGGGGAGAGGGAGACAGGTGGG - Intergenic
907305933 1:53513224-53513246 CTGGGGAGGGGGAGCCCGGAAGG - Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907450582 1:54543178-54543200 CGGGGGAGAGGGACAAAGGAAGG - Intronic
907472473 1:54682837-54682859 CAGGAGGGAAGGAGAGAGGAAGG - Intronic
907478622 1:54726878-54726900 CTTGGGAGACTGAGGCAGGAGGG - Intronic
907522617 1:55034100-55034122 CTGGGGCGAATGAGACAGGAAGG + Intergenic
907652367 1:56307565-56307587 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
907863801 1:58379188-58379210 CTGGGGGGGAGGAGCCAAGATGG - Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
907926142 1:58956802-58956824 CTGGGTATAGGGAGAAAGGAAGG - Intergenic
908466856 1:64404653-64404675 ATGGGGAGAAGGAAGCAAGAGGG - Intergenic
908961384 1:69700512-69700534 CTGTGAGGAAGGAGACATGAAGG - Intronic
909914734 1:81302995-81303017 CTGGGGAGCAGGTCACAGAAAGG - Intergenic
910169806 1:84366136-84366158 CTGGGGACTTGGAGTCAGGAAGG - Intronic
910297815 1:85669155-85669177 CTGGGGAGAGGTTTACAGGAAGG + Intronic
910309550 1:85808111-85808133 TTGGTGAGGAGGGGACAGGAAGG - Intronic
910480246 1:87650830-87650852 GTAGGGAAAAGGAGAAAGGAAGG - Intergenic
910802677 1:91161378-91161400 GTGGACTGAAGGAGACAGGAAGG + Intergenic
910852902 1:91666103-91666125 GTTGGGAGAAGGAGGCTGGATGG + Intergenic
910938782 1:92510349-92510371 CTTTGGAGAAGGAGAAAGAAAGG - Exonic
910946655 1:92599990-92600012 CTGGAGAAAAGGAAACTGGATGG + Intronic
911236021 1:95413240-95413262 AAGGGGAGCAGGAGACAGAAGGG - Intergenic
911538150 1:99125230-99125252 GTGGGAAGAGGGAGAGAGGAAGG - Intergenic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
911732854 1:101308266-101308288 CAGGGGAGAAGGACAAGGGAAGG - Intergenic
912229390 1:107774697-107774719 TTGGGGAGAAAGCCACAGGATGG - Intronic
912306072 1:108568806-108568828 CTGGGAAGGAGGAGAGGGGAAGG + Intronic
912373601 1:109192588-109192610 CTGGAGACAAGGAAACAAGAGGG - Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
914245729 1:145884800-145884822 CTGGGGAAAAGCAGGCAGAAAGG + Intronic
914418897 1:147510254-147510276 CTGGGGAAAAGAAGCCGGGAAGG + Intergenic
914512942 1:148350825-148350847 CAAAGGAGAAGGAGACAGGGAGG + Intergenic
914756307 1:150563339-150563361 CTGGGGACAAGGGGAGAGCAAGG - Intergenic
914806755 1:150997459-150997481 GTAGGGAGAGGAAGACAGGAAGG + Intronic
915089869 1:153416843-153416865 CAGGGAGGAAGAAGACAGGAAGG - Intronic
915205786 1:154269558-154269580 GAGGGGAGGAGGAGAGAGGAAGG - Intronic
915334101 1:155130457-155130479 CTTGGGAGGAGGGGAGAGGAGGG + Intronic
915347212 1:155203597-155203619 TTGGTGAGAAGGAGGAAGGAAGG + Intronic
915507115 1:156364855-156364877 CAGGGTAGGAAGAGACAGGATGG - Intronic
915519559 1:156433868-156433890 TGGGGGAGAAGCAGGCAGGAGGG - Intergenic
915627515 1:157124619-157124641 CTGGTGAGTAGGACACAGGGAGG - Exonic
916415528 1:164588981-164589003 CTGGGGAGGAGGGGAGAGGCCGG - Intronic
916516097 1:165517991-165518013 CCTGGGAGAAGGAGAGAGGTGGG + Intergenic
916989445 1:170226612-170226634 ATGGAAAGAAGGAGAGAGGAAGG - Intergenic
917482933 1:175427925-175427947 CCTGGGAAATGGAGACAGGAAGG - Intronic
917503942 1:175611438-175611460 CTTGGGAGGCTGAGACAGGAGGG - Intronic
917512720 1:175681579-175681601 CTGGAGGGCAGGAGACAGGAAGG - Intronic
917918985 1:179733809-179733831 CTTGGGAGAAGGTCACAGGAAGG + Intergenic
918087497 1:181258055-181258077 CTGAGGGGTAGGAGAGAGGACGG + Intergenic
918096856 1:181343176-181343198 CTGGGGTGGAGGAGGCTGGAGGG + Intergenic
918707283 1:187681126-187681148 GTGGGGAGAAAGAGAGAGTAGGG - Intergenic
919468039 1:197945811-197945833 GTGAGGAGAAAGAGACAAGAAGG + Intergenic
919499258 1:198315444-198315466 ATGGGGAGGAGGAGCCAAGATGG - Intronic
919763567 1:201112691-201112713 AGTGGGAGAGGGAGACAGGATGG + Intergenic
919862769 1:201752696-201752718 TTGAGGAGAAGGAGACAGAGAGG + Intronic
919952458 1:202377797-202377819 ATGGGGAGCAGGAGAAAGAAAGG + Intronic
920032502 1:203045770-203045792 GTGGGGAGGTGTAGACAGGATGG + Intronic
920034909 1:203059450-203059472 CTAGGGAGAAGGAGGCAAGGGGG + Intronic
920108390 1:203570345-203570367 TTAGGGAGCAGGAGACAGGCAGG - Intergenic
920203735 1:204276565-204276587 CAGAGCAGAAGGAGACTGGAGGG - Intronic
920221166 1:204402513-204402535 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
920496498 1:206458695-206458717 CTGGGGAGGAGGAGTCAGTCAGG - Exonic
920619923 1:207535014-207535036 CTGAAGAGAGGGAGACAGAAGGG - Intronic
920621704 1:207553569-207553591 CTGAAGAGAGGGAGACAGAAGGG - Intronic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
920623330 1:207570664-207570686 CTGAAGAGAGGGAGACAGAAGGG - Intronic
920662762 1:207931555-207931577 TTGGGGAGAGGGAGAGAGAAGGG + Intergenic
920792479 1:209106330-209106352 CTGGGCTGAGGCAGACAGGATGG + Intergenic
921064965 1:211616290-211616312 CTGGGGTAAGGGAGACAGGCTGG + Intergenic
921257233 1:213353623-213353645 CTGGGTAGAAAGAGCCAGAAAGG - Intergenic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
921540001 1:216402491-216402513 CTGAGGAGGAGGAGAAAGAAGGG - Intronic
922061586 1:222097642-222097664 CCGGAGAGAAGGGGACAGGAGGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922118997 1:222644041-222644063 CTGGGGAAAAGGAGAAAAGCAGG - Intronic
922259581 1:223925955-223925977 CTGGGGAGACTAATACAGGAGGG - Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922366428 1:224868736-224868758 CTGGGAAATAGGAGACAGAAGGG + Intergenic
922414818 1:225411566-225411588 GTGGTGAGAGGCAGACAGGACGG + Intronic
922531715 1:226350070-226350092 GAGGAGAGAAGGAGGCAGGATGG - Intergenic
922542316 1:226428702-226428724 CTGGGGAGGGAGAGAAAGGATGG - Intergenic
922616666 1:226964923-226964945 CTGGGCAGCAGGGGACAGGCAGG + Intronic
922723309 1:227909860-227909882 GAGGGGAGGAGGAGGCAGGAGGG + Intergenic
922802826 1:228371946-228371968 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
922963220 1:229665649-229665671 CAGGGAAAAAGGGGACAGGATGG - Intergenic
923051301 1:230393022-230393044 AGGGGGAGAGGGAGAAAGGAAGG + Intronic
923602184 1:235412634-235412656 CTGGGAAGAAGTGGCCAGGAGGG - Intronic
923666508 1:236002986-236003008 CTGGGGAGAGTGAGAGAGGGAGG - Intronic
924695140 1:246391472-246391494 AGGGAGAGAAGGAGAGAGGAGGG + Intronic
1062976900 10:1690768-1690790 CTGGGGAGGGGGTGACAGGAAGG - Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063220921 10:3967056-3967078 CTGGGGCGAAGGAGAGAGGGTGG - Intergenic
1063223408 10:3992423-3992445 GTGGGGAGGAGGGGACAGAAAGG - Intergenic
1064025569 10:11846092-11846114 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1064504016 10:16009857-16009879 TTAGGAAGAAGGAGAGAGGATGG + Intergenic
1065118420 10:22504705-22504727 TTGGGGAGAGAGAGACATGAGGG - Intergenic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1065487619 10:26249921-26249943 GGGCGGAGAAGGAGGCAGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066103494 10:32137745-32137767 CTGGGGAGAAGGGGAGAGGTCGG + Intergenic
1066118744 10:32263294-32263316 CTTGGGTGACAGAGACAGGAGGG + Intergenic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1067523985 10:47027475-47027497 CTGGGGAGAGGGAGAGAGCCAGG + Intergenic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067832778 10:49620010-49620032 CAGGGCAGAAGGAGAGATGAGGG + Intronic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1068528867 10:58162565-58162587 CTGAGGAGGAGTACACAGGAAGG - Intergenic
1069230352 10:66001266-66001288 CCAGGGAGAAGGAGAGAGGGAGG - Intronic
1069506388 10:69002056-69002078 CTTGGGAGATTGAGGCAGGAGGG + Intronic
1069562179 10:69438532-69438554 GTGTGGAGAAAAAGACAGGAAGG - Intergenic
1069795436 10:71048906-71048928 CTGAGGGGCAGGAGACAGGCAGG + Intergenic
1069847234 10:71380679-71380701 CTGGGAGGAAGGAGACAGAAAGG + Intergenic
1069868377 10:71518272-71518294 CTGGGAGGCAGGACACAGGATGG - Intronic
1069890449 10:71649110-71649132 CTGGGGAGACTGGGAGAGGAAGG - Intronic
1069893730 10:71667752-71667774 AAGGGGACAAAGAGACAGGAGGG + Intronic
1070108902 10:73463298-73463320 CTGTGGTGAAGTAGACTGGAAGG - Intronic
1070153153 10:73817712-73817734 CTGCAGAGAGGGAGACGGGAGGG - Intronic
1070225275 10:74497721-74497743 CTTGGGAGGCAGAGACAGGATGG + Intronic
1070321947 10:75361004-75361026 CTGTGGTGCAGGAGACAGCAGGG + Intergenic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1070813598 10:79310530-79310552 CCGGGGAGCGGGAGGCAGGAGGG - Intronic
1070985465 10:80686180-80686202 CTGGGAGGAAGGAGACAGTGAGG + Intergenic
1071242022 10:83717722-83717744 CTGAAGAGAAGGAGACATGAGGG - Intergenic
1071293228 10:84202008-84202030 TTGGAGAGCAGGAGACATGATGG + Intronic
1071526691 10:86363470-86363492 CCCGGGAGAAGGAGACAGGTCGG + Intronic
1071605062 10:86980204-86980226 CTGGGGAGGAGGGGACAGGGAGG + Intronic
1072001286 10:91198238-91198260 CTGAGGTCAGGGAGACAGGATGG - Intronic
1072205247 10:93198268-93198290 AGGGCGAGAAAGAGACAGGAAGG + Intergenic
1072209226 10:93231392-93231414 CTGGGGAGGAGAAGGCAGGGCGG + Intergenic
1072231024 10:93414113-93414135 CTGGCTAGGAAGAGACAGGAAGG - Intronic
1072427146 10:95339159-95339181 TTGGGGAGGAGGAGAAAGGCAGG + Exonic
1072534635 10:96352816-96352838 CTGGAGCGAAGGAGAAAGGAGGG - Intronic
1072743186 10:97922522-97922544 CAGGGGAGCAGGTGACAGGAGGG + Intronic
1073134296 10:101211562-101211584 CTGGGGAGGAGTAGATGGGAAGG + Intergenic
1073201827 10:101741433-101741455 CCGTTGAGAAGAAGACAGGATGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073866975 10:107816261-107816283 CTGGGGAGATGGTGATAGCAAGG - Intergenic
1074642374 10:115401363-115401385 CTGTGGAGAAAGAGCCAGTAAGG + Intronic
1074740102 10:116478293-116478315 CTGGGGAGAAGGAGGAAAGCAGG + Intergenic
1074972512 10:118550723-118550745 CTGGGCAGAGGCAGACAGGAAGG + Intergenic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1075341264 10:121648436-121648458 CTAGGTAGTAGGAGGCAGGAAGG - Intergenic
1075481604 10:122787128-122787150 CTGGGAATAAGGAGTCAGGTGGG + Intergenic
1075518914 10:123132409-123132431 CTTGGGACAAGGAGCCAAGAGGG - Intergenic
1075538833 10:123295265-123295287 GTGGGGAGTGGGAGAAAGGAGGG - Intergenic
1075558567 10:123450709-123450731 ACGGGGAGAAGGTGACAGAAGGG + Intergenic
1075575037 10:123571775-123571797 CTGGGGTGAAGGAAGCTGGACGG + Intergenic
1075703172 10:124482600-124482622 CTGGGGGGAGGGTGACAGGCAGG - Intronic
1075974779 10:126685827-126685849 ATGGGGAGGAGGAGATTGGATGG - Intergenic
1076071264 10:127491743-127491765 CTTGGGACCAGGAGCCAGGACGG + Intergenic
1076203029 10:128573105-128573127 CAGGGGAGCAGGGGACAGGCAGG + Intergenic
1076418770 10:130312959-130312981 CTAGGGAGAAGCAGAAAGGAGGG + Intergenic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1076744209 10:132504692-132504714 CTGGGTAGAAGGAAACAGCAGGG - Intergenic
1076880016 10:133235568-133235590 CTGGGAGGAAGGAGGCAGGGGGG + Intergenic
1076923772 10:133470678-133470700 CTGAGGGGCAGGACACAGGAAGG - Intergenic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1078334794 11:10455134-10455156 CTGGGGAGAAGAGCTCAGGAAGG - Intronic
1078484242 11:11706909-11706931 CTGGCGAAATGGAGACAGGGAGG + Intergenic
1078516763 11:12029114-12029136 TTGGGGAAAAGGAGTCAGGCTGG + Intergenic
1078593442 11:12665821-12665843 CTGGTTAGAAGCAGAGAGGAGGG + Intergenic
1078599157 11:12715389-12715411 CTGGGGAGGAGGAGAGGGTATGG + Intronic
1078605440 11:12771085-12771107 TTGGGGAAAAGGAGAAGGGAAGG + Intronic
1078617956 11:12882403-12882425 TTGTGGGGAAGGAGACAGGTAGG - Intronic
1078725786 11:13929763-13929785 CTGGGCAGCAGGAGACAGCAGGG + Intergenic
1078971668 11:16419931-16419953 CGGGGGAAAAGGTGACAGAATGG + Intronic
1079287944 11:19156735-19156757 TTGTGGAGATGGAGACAGGCAGG - Intronic
1079328233 11:19512448-19512470 CTGGGGAGAACCAGAGAGGGAGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080299149 11:30764983-30765005 TTGTGGGGGAGGAGACAGGATGG + Intergenic
1080563147 11:33483077-33483099 AGGAGGAGGAGGAGACAGGAGGG - Intergenic
1081103836 11:39039325-39039347 TTGGGGAGAAGGAGTCAGAAGGG + Intergenic
1081171452 11:39874598-39874620 ATGGCGGGAAGGAGGCAGGAGGG - Intergenic
1081534736 11:43988429-43988451 CTAGAGGGAAGGTGACAGGAGGG + Intergenic
1081759864 11:45569672-45569694 CTGGGGAGGAGGGGAAGGGAGGG + Intergenic
1081789400 11:45772146-45772168 CTGGGGAGCAGGAGAAAGCCAGG - Exonic
1081896719 11:46593496-46593518 GGGGGGAAAAGGAGAAAGGAAGG + Intronic
1082780903 11:57286876-57286898 CTGGGCAGAAGGGCAGAGGAGGG - Intergenic
1083079627 11:60077160-60077182 CTGGGGAGCAGGGGACGGGAGGG + Intergenic
1083186057 11:61018481-61018503 AAGGGGAAAAGGAGAAAGGAAGG + Intronic
1083221306 11:61254564-61254586 CTGGGGACAAGCAGAAAGGCAGG + Intergenic
1083357888 11:62080821-62080843 CTGGGGAGCAGGATAGAAGAGGG + Intergenic
1083593175 11:63907025-63907047 CAGGGGTGAAAGAGCCAGGAAGG - Intronic
1083856695 11:65396569-65396591 CTCGGCAGAAGCAGACAGGCTGG + Intronic
1083946865 11:65928496-65928518 CTGGGGAGACTGAGGCAGAAAGG - Intergenic
1084167465 11:67382549-67382571 CTGGGGAGATGGGGGCAGGGAGG - Intronic
1084361235 11:68669809-68669831 CTGGGGAAAAGGGGTCAGGGTGG - Intergenic
1084368879 11:68724626-68724648 CTGGGGAAGAGAAAACAGGAGGG - Intronic
1084389115 11:68863484-68863506 CTGGGGAGGGGGTGGCAGGAGGG - Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084608675 11:70187059-70187081 CTGGGAAGAGGGAGATGGGATGG + Intronic
1084630037 11:70342001-70342023 GTGGGGAGAGGAAGACAGAATGG + Intronic
1084758910 11:71256067-71256089 GTGGGGAGCAGCAGGCAGGAGGG + Intergenic
1084862028 11:72025264-72025286 ATGAGGAGAGGGAGACAGCAGGG + Intronic
1084942596 11:72620866-72620888 TGGGGGAGAGGGAGAGAGGAGGG + Intronic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085228331 11:74942871-74942893 CTGAGAGGAAGGAGACAGCAAGG + Intronic
1085451972 11:76639576-76639598 GTGGGGAGAACAGGACAGGAAGG + Intergenic
1086832920 11:91587648-91587670 AGGGTGAGAAGGTGACAGGAGGG - Intergenic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1087214578 11:95481801-95481823 GTGGGGAGAGGGAGACAAGAGGG - Intergenic
1087629285 11:100631564-100631586 CTGTGGAGCAGAAGACAGGAAGG + Intergenic
1088235542 11:107719077-107719099 CAGGGGACAAGAAGACTGGATGG + Intronic
1088271520 11:108039374-108039396 GTGGGGAGAAAGACACAGAAGGG - Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088579269 11:111299759-111299781 CGGGGGCGAAGGAGGGAGGAGGG + Intronic
1088626389 11:111733326-111733348 CTGGGAGGGTGGAGACAGGAGGG + Intronic
1088747182 11:112813937-112813959 CTAGGGAGAAGGTCACAGGGAGG + Intergenic
1088862433 11:113814355-113814377 CTAGACAAAAGGAGACAGGAAGG + Intronic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089038812 11:115426057-115426079 CAGGTGACAAGGAGGCAGGAGGG + Intronic
1089223060 11:116891371-116891393 CTTGGGAGACTGAGGCAGGAGGG + Intronic
1089306927 11:117532339-117532361 CTGGGGAGAACGGGGCAGGCTGG - Intronic
1089459072 11:118642214-118642236 GAGGGGAAAAGGGGACAGGAGGG - Intronic
1089590891 11:119540165-119540187 CTGAGGAGAAGGAGACACCTAGG - Intergenic
1089737091 11:120557005-120557027 GTGGGCAGGAGGAGACTGGACGG - Intronic
1089796993 11:120988930-120988952 GTGGAGAGAAGGAGACAGAGAGG - Intergenic
1090062615 11:123477235-123477257 AGGGGGAGAAGGGGAGAGGATGG - Intergenic
1090263293 11:125338182-125338204 ATGGGCAGAGGGAGACAGGGAGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090531008 11:127591740-127591762 AGGGAGAGAAGGAGAAAGGAAGG + Intergenic
1090827965 11:130401190-130401212 CTCAGTAGAAAGAGACAGGAAGG - Intergenic
1090922993 11:131223544-131223566 CTGGGGTGAAGAAGAGAGAAAGG - Intergenic
1091110064 11:132957868-132957890 CTGAGGAGAAGGAGAGAGACTGG - Intronic
1091138030 11:133210396-133210418 CTGGGAAGAGGGAGAGAGAAGGG - Intronic
1091227502 11:133966320-133966342 ATGGGGAGAAGGAGACGGAGGGG + Intergenic
1091300455 11:134503933-134503955 CTGGGGAGGAGGAGGCTGGGAGG + Intergenic
1091454946 12:599944-599966 CTGGGCAGAAGGAGGCGGGCTGG - Intronic
1091554191 12:1559886-1559908 CTGGGGAGAAGGAGTAAAAATGG - Intronic
1091676349 12:2493450-2493472 ATGGGGAGGAGGAGAAAGGGAGG - Intronic
1091723024 12:2827057-2827079 CTGGGGAAAATGGGACAGCAGGG + Exonic
1091776257 12:3186828-3186850 CTGGGGAGGAGGGGGCAGGATGG + Intronic
1091824953 12:3505210-3505232 TTGGGGAGGAGGAGCCAAGATGG - Intronic
1091898084 12:4120624-4120646 GTGGGGTGAGGAAGACAGGATGG - Intergenic
1092041900 12:5392788-5392810 ATGGGGAGAAGAGGAGAGGAAGG - Intergenic
1092203759 12:6603361-6603383 TTGGGAAGAGGGAGAGAGGAGGG - Intronic
1092299727 12:7235265-7235287 GTGGGGAGGAGAAAACAGGAAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092699515 12:11212337-11212359 CTGGAGGGAGGGAGAGAGGAGGG + Intergenic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093111791 12:15161467-15161489 ATGGGAAGAAGGAGGAAGGAAGG - Intronic
1093618964 12:21264543-21264565 CTAGGGAAGAGGAGAAAGGAAGG + Intergenic
1093905786 12:24690627-24690649 CTGGAGGGAAGCAGAGAGGATGG - Intergenic
1093971413 12:25379495-25379517 CTGGAGACAAAGAGACAAGATGG - Intergenic
1094151789 12:27293057-27293079 CTTGGGAGGCTGAGACAGGAGGG - Intronic
1094278557 12:28708114-28708136 CTGGGGAGAAAGAGCCATGGGGG + Intergenic
1094718654 12:33038740-33038762 CTTTGGAGATGGAGAAAGGAAGG - Intergenic
1095308751 12:40669753-40669775 CTTTGCAGAAGGAGACAGGAAGG - Intergenic
1095319077 12:40803787-40803809 ATGATGAGAAGGATACAGGAAGG + Intronic
1095882914 12:47157480-47157502 CTGGGGAGGTTGAGGCAGGAAGG + Intronic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096096808 12:48940854-48940876 CTGGGGAGAAGAGGCCAGGTTGG + Intronic
1096237490 12:49939723-49939745 CTGGGGTGAAGGGCATAGGATGG - Intergenic
1096242747 12:49968023-49968045 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
1096413040 12:51391101-51391123 CTGAGCAGAAGGGGACAGCAAGG - Intronic
1096428601 12:51524679-51524701 CTCAGGCTAAGGAGACAGGAAGG - Intergenic
1096575585 12:52550732-52550754 CTGGGGAGCAGGACCAAGGAGGG - Intronic
1096606845 12:52772732-52772754 TTGGGAAGAATCAGACAGGAAGG + Intronic
1096633415 12:52944058-52944080 ATGGGGCAAAGCAGACAGGAGGG + Intronic
1096676271 12:53227688-53227710 CTAGGGAGAAAGAGAGAGAAAGG + Intronic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1097711240 12:62919886-62919908 ATGGGGAGAAGAGGACAGGCAGG + Intronic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1098349409 12:69541715-69541737 CTCGGGAGACTGAGGCAGGATGG + Intronic
1098880868 12:75915790-75915812 CTGGGTTGAAGGAGATAGGAAGG + Intergenic
1099102683 12:78461331-78461353 CAGGGGAGAAGGACAAGGGAAGG + Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100436125 12:94573128-94573150 CTGAGAAGAAGGACACTGGAAGG - Intronic
1100585832 12:95978380-95978402 TAGGGGAGAAAGAGACATGATGG + Intronic
1100647142 12:96543469-96543491 CTGGGGGTAAGAAGCCAGGAGGG + Intronic
1100873672 12:98939999-98940021 CTGGGGAAAAGGGCACAGGGAGG + Intronic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101345038 12:103878953-103878975 CAGGGGAGAAGGAAGCAGCAAGG - Intergenic
1101708526 12:107243314-107243336 TTGAGGACAAGGAGGCAGGAAGG + Intergenic
1101744949 12:107532337-107532359 CTGGGGACAAGGATGCTGGATGG - Intronic
1102069983 12:110010604-110010626 CTGGGCTCCAGGAGACAGGAAGG + Intronic
1102133439 12:110552452-110552474 CAGGGTAGAAGGAGAGGGGATGG - Intronic
1102219671 12:111186095-111186117 CTAGTGAGACGGAGACAGAAAGG - Intronic
1102237633 12:111304187-111304209 CTGGGGAGAAGGGGACAGTGTGG - Intronic
1102240088 12:111319989-111320011 CTGCGGGGAGGGGGACAGGACGG - Intronic
1102309649 12:111835297-111835319 ATGGGGAGGAGGAGCCAAGATGG - Intergenic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102749180 12:115277268-115277290 CGGGGGAGAAGGAGAGGGGGAGG + Intergenic
1102768422 12:115452465-115452487 GTGGGGAGTAGGAGACAGAAAGG - Intergenic
1102840414 12:116113856-116113878 AGGGGGAGAGGGAGACAGAAGGG + Intronic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103509720 12:121466589-121466611 GTGGGCAGACGGAGACAGGAAGG - Intronic
1103594924 12:122019080-122019102 ATGAGGAGAAGGAGAGAGGGAGG - Intergenic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103620397 12:122183719-122183741 CTGGAGACAGGGAGGCAGGATGG - Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1103929344 12:124440966-124440988 CTGGGGAGGGGCAGAGAGGACGG + Intronic
1103977855 12:124715378-124715400 GTGGAGAGAAGGGGACAGGGAGG - Intergenic
1103992111 12:124806213-124806235 GTGGGGAGCAAGAGAGAGGAAGG + Intronic
1104235788 12:126935234-126935256 GTGGGGAGAAGGGGACAGTAAGG + Intergenic
1104301397 12:127568343-127568365 GAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1104348324 12:128022643-128022665 ATGGGGAGAGTGAGAAAGGATGG - Intergenic
1104757662 12:131279158-131279180 GTGGGGAGAGGGAGAGGGGAAGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104850661 12:131871993-131872015 ATCGGGGGATGGAGACAGGAGGG + Intergenic
1104871675 12:132003101-132003123 CTTGGGAGACTGAGGCAGGATGG + Intronic
1105351930 13:19623692-19623714 GTGGGGAAAAGGAGGCAGGTGGG - Intergenic
1105426933 13:20302121-20302143 GCGGGAAGCAGGAGACAGGATGG - Intergenic
1105550623 13:21392133-21392155 TTGGGGAGACTGAGACAAGAGGG + Intronic
1105734288 13:23251663-23251685 CTGGGGAGTCTGAGACAGGGAGG + Intronic
1105872093 13:24514391-24514413 CTGGGGACAACTAGACAGGGAGG + Intergenic
1106498325 13:30303455-30303477 CTGGGGAGGCTGAGACAGGAAGG + Intronic
1106624864 13:31410259-31410281 ATGGGCAGCAGGAGAAAGGAAGG - Intergenic
1107146513 13:37066428-37066450 CTGGAGAGAGGGAGTCAGGCGGG - Intergenic
1107374858 13:39792551-39792573 CTGAGGAGGAGGAGAAAGGGGGG + Intergenic
1107419719 13:40234911-40234933 CTGGGCAGAAGGAAAAAGGCTGG + Intergenic
1107569175 13:41638470-41638492 CTGAGAAGAAGCAGACAAGAGGG + Intronic
1108688898 13:52845734-52845756 CTGGGGGAAGGGAGACTGGAGGG - Intronic
1108733428 13:53258113-53258135 CTTGGGAGGCTGAGACAGGAGGG + Intergenic
1109033331 13:57222160-57222182 CTGAAGGGAATGAGACAGGAAGG + Intergenic
1109234015 13:59793302-59793324 CTGGGAGGAATGAGAAAGGAGGG - Intronic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1109694656 13:65938198-65938220 ACGGGGAGAAGGAAACAGGGCGG + Intergenic
1109712654 13:66180556-66180578 CTGGGGGAAAGAAGACAGGGTGG + Intergenic
1110692634 13:78449306-78449328 ATGAAGAGAAGAAGACAGGAAGG - Intergenic
1111032532 13:82622706-82622728 GTGGGGAGCAGGAGATAAGATGG + Intergenic
1111086346 13:83380469-83380491 GGGGGGAGGAGGAGAAAGGAAGG - Intergenic
1111368225 13:87279096-87279118 CTTGGGAGATGGAGGCAGGAGGG - Intergenic
1111466662 13:88622353-88622375 CTCGGGAGAAGGACAGAGAAGGG + Intergenic
1111501437 13:89126063-89126085 CTGTGGGGAAGCAGAGAGGAAGG + Intergenic
1111508075 13:89221548-89221570 CTTGGTAGAAGGAGACAAGATGG + Intergenic
1112108798 13:96271658-96271680 CTTGGGAGAAGGTGACATGTAGG + Intronic
1112376619 13:98848275-98848297 CTGGGGAGAAGAGGATGGGAAGG + Intronic
1112580112 13:100671238-100671260 CTTGGGAGACCGAGGCAGGAGGG - Intronic
1112686756 13:101837979-101838001 CATGGGAGAAGGACACAGGCCGG - Intronic
1112833117 13:103478084-103478106 ATGGGAGGAAGGAGAGAGGAAGG + Intergenic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113301996 13:109032396-109032418 CTGGGAAGAAGCACAAAGGATGG - Intronic
1113352492 13:109542969-109542991 CTGGTGAGAAGAAGAAAGGGAGG - Intergenic
1113478245 13:110600722-110600744 CTGGGGCAAAGGACACGGGAGGG - Intergenic
1113547020 13:111160806-111160828 CAGGGCAGCAGGAGACAGAAGGG - Intronic
1113589943 13:111491431-111491453 ATGGGGAGAGGGAGAAAGGGAGG - Intergenic
1113937458 13:114001928-114001950 GTGGGGAGCAGGAGACAGGATGG + Intronic
1113986084 13:114316923-114316945 CTGGGGACAAGAAGATAGGTGGG + Intronic
1114164997 14:20212049-20212071 CTGGGGAGAGGGAGACCGTGGGG - Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114525815 14:23366303-23366325 CTGGGGATTAAGAGAAAGGAGGG + Intergenic
1115259632 14:31438186-31438208 GTGGGGAGAGGGAGACCGTAGGG + Intronic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1116047381 14:39761264-39761286 CTTGGGAGGCTGAGACAGGAGGG + Intergenic
1116472990 14:45306704-45306726 CTTGGGAGAAAGGGACAAGATGG - Intergenic
1116499467 14:45602676-45602698 CTGAGGAGAGGGAGACAGATGGG + Intergenic
1116848407 14:49885593-49885615 CTGGCGAGAAGGAGGCAGGCTGG - Intergenic
1116909083 14:50438778-50438800 TTGGGGAAATGGAGAAAGGAAGG - Intronic
1117069545 14:52044057-52044079 CTGGAAACGAGGAGACAGGAGGG + Intronic
1117070136 14:52048788-52048810 CTCGGGAGAAGGAGACATTTGGG + Intronic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117366268 14:55031627-55031649 GTGGGGAGAAAGGGAAAGGAGGG + Intronic
1117694111 14:58341026-58341048 ATGGGGAGAGGGAGAGAGAAGGG - Intronic
1117940473 14:60959024-60959046 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1118184942 14:63529066-63529088 CTTGGGAGGCCGAGACAGGAAGG - Intronic
1118225025 14:63890564-63890586 ATGAGGGGAGGGAGACAGGAGGG + Intronic
1118287664 14:64491221-64491243 CTTGGGAGGATGAGGCAGGAGGG + Intronic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118318854 14:64741828-64741850 GTGGGGAGCAAGAGACAGGTGGG + Exonic
1118320239 14:64748610-64748632 GGGGGGAGAAGCAGAGAGGAGGG + Exonic
1118428796 14:65693527-65693549 GTGGGGAGAGGGAGAGAGGGAGG + Intronic
1118598605 14:67455179-67455201 CTGGGCAGCAGCAGACAGGCTGG - Intronic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119206135 14:72794959-72794981 CTTGCAAGAGGGAGACAGGACGG - Intronic
1119585758 14:75833296-75833318 CTGGGGACTGGGTGACAGGAGGG - Intronic
1119610413 14:76056971-76056993 GAGGGCAGAAGGAGACAGAATGG - Intronic
1120157871 14:81114162-81114184 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1120185030 14:81385532-81385554 CTGAAAAGAAGGGGACAGGATGG + Intronic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120995111 14:90411633-90411655 ATGGGGGGAAGGAGGCAGAAAGG - Intergenic
1121073605 14:91047941-91047963 CTTGTAAGAGGGAGACAGGAGGG - Intronic
1121405688 14:93717965-93717987 CTGGGGAAAATGGGACAAGAAGG - Intergenic
1121540805 14:94724821-94724843 ATGGGAAAAAGGAGACAGCAAGG + Intergenic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1121608037 14:95255576-95255598 CTGCAGAGAAGGAGGCAGTAGGG + Intronic
1122003317 14:98682505-98682527 CTGGGGAGGAGAAGAAAGGGAGG + Intergenic
1122003496 14:98683733-98683755 CTGGGGAGGAGAAGAAAGGCAGG + Intergenic
1122200344 14:100118772-100118794 CTGGGGAGAAACACACAAGAGGG - Intronic
1122529991 14:102418759-102418781 CCGGGTAGGAGAAGACAGGATGG + Intronic
1122635582 14:103128153-103128175 TAGGGGAGAAGGTGAGAGGAAGG + Intronic
1123067693 14:105626758-105626780 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123071712 14:105645483-105645505 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123091376 14:105743759-105743781 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123097147 14:105772100-105772122 CTGGGGCTAAGGGGAAAGGAGGG - Intergenic
1123415159 15:20089954-20089976 AGGGAGAGAAGGAGTCAGGAAGG - Intergenic
1123524501 15:21097068-21097090 AGGGAGAGAAGGAGTCAGGAAGG - Intergenic
1123780130 15:23618006-23618028 GAGGGGGGAAGGTGACAGGAGGG + Intronic
1124004653 15:25786074-25786096 GTGGGGAGAAGGAGAGCTGAGGG + Intronic
1124475521 15:30030281-30030303 CTGGGGAGAAGGGAAAATGAGGG - Intergenic
1124594461 15:31081628-31081650 TTGGGGAGGAGGGGACAGGCAGG - Intronic
1125039048 15:35161917-35161939 CTGAGGAGAAGCAGTCTGGAAGG - Intergenic
1125370666 15:38972801-38972823 TGTGGGAGAAGGAGAAAGGAAGG + Intergenic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1125736303 15:41928869-41928891 CTGGGGAAAAGGGGGCAGGGAGG - Intronic
1126002639 15:44225860-44225882 CTTGGGAGGATAAGACAGGAGGG - Intergenic
1126104393 15:45138157-45138179 CTGGGGTGAAGGAGGCAGCCTGG + Intronic
1126110896 15:45174122-45174144 GTGGGGAAAAGGAGAAAGGGAGG - Intronic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126947243 15:53835348-53835370 CTAGGAAGATGGAGAGAGGAAGG + Intergenic
1127016849 15:54698815-54698837 CGGGAGAGAAGGAGCCAAGATGG + Intergenic
1127166510 15:56249436-56249458 CTGGGGAGAGAGAGAGAGGGAGG + Intronic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1127609207 15:60620825-60620847 CTGGGGAGAGGGGGACAGCCCGG + Intronic
1128113801 15:65093232-65093254 CTGAGGAAGAGGAGACAGGGAGG + Intronic
1128334062 15:66774793-66774815 CTGGGGAGAGGGAGACAGCTGGG - Intronic
1128375873 15:67075428-67075450 CTGGGGAGCAGGAGAGGGGGAGG + Intronic
1128602675 15:69011025-69011047 CTCGGGAGACTGAGGCAGGAGGG + Intronic
1128638394 15:69317775-69317797 ATGGGGAGAAGGGGAAAGGAGGG - Intronic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1128957220 15:71960938-71960960 CTGGGGACAAGGAGAAAGTGTGG + Intronic
1129150402 15:73684586-73684608 CAGGGGAGCAGGAGCCCGGAGGG - Intronic
1129325230 15:74796800-74796822 CTTGGGACAGGGAGACTGGAAGG - Intronic
1129477871 15:75798453-75798475 CTGTGAAGAAGGTGAAAGGAAGG + Intergenic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129604452 15:77018030-77018052 CAGGGGAGATGGAGGCAGGAGGG + Intronic
1129658925 15:77542398-77542420 TTGGGGAAAAGGAGACAGCCAGG - Intergenic
1129977317 15:79833061-79833083 CTGGGGAGCTGGAGCTAGGATGG + Intergenic
1130040516 15:80402599-80402621 GTGGGGAGAAGGATCCAGAAGGG + Intronic
1131529523 15:93179842-93179864 CAGGGAAGAGGGAGAAAGGATGG + Intergenic
1131626033 15:94121931-94121953 CTGGGGAGAAGGAGACAGAGGGG - Intergenic
1131818326 15:96245879-96245901 GTGGGGAGAGGGAGATAGGCAGG + Intergenic
1132053021 15:98626250-98626272 GTGGGGACAGGGAGGCAGGATGG - Intergenic
1132129249 15:99260108-99260130 CAGGGGAGAAGGGGACTGGTGGG - Intronic
1132240084 15:100251154-100251176 CTGGGGATCAGGAGATAGGCTGG + Intronic
1132322397 15:100935595-100935617 CTGGAGAGAAGGCACCAGGAGGG + Intronic
1132507829 16:321155-321177 GTGGGTAGCAGGAGGCAGGAGGG - Intronic
1132606094 16:794357-794379 GTGGGGAGCAGGAGCCAGGAGGG + Intronic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132794821 16:1714640-1714662 CTGGGGAGAAGGAAAGGTGATGG - Intronic
1133022362 16:2972409-2972431 CTGGGCAGAGGGAGCCAGGGCGG - Exonic
1133038165 16:3046213-3046235 CTGGGGGGAAGGAGAGGGGCGGG + Intergenic
1133071105 16:3247247-3247269 CTGGGGAGCAGAGGACAGGGAGG + Intronic
1133258929 16:4536069-4536091 CTGGTGAGAAGGTGGCAGGCAGG - Intronic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1133873824 16:9714268-9714290 GTGGGGAGAGGGAGATTGGAAGG - Intergenic
1133959458 16:10480354-10480376 ATGGTGAGAAGAAGAAAGGAAGG - Intronic
1134006406 16:10821296-10821318 TTGGGAGGAAGGAGGCAGGAGGG + Intergenic
1134086156 16:11358780-11358802 CTGAGGAGGAGAAGAAAGGAAGG + Intergenic
1134132459 16:11659034-11659056 CTGGTGAGAAGGAGCCTGCAAGG + Intergenic
1134194932 16:12152425-12152447 GTGGGGAGCAGGAGACAGTGTGG + Intronic
1134331081 16:13251678-13251700 CTTGGAAGAATGAAACAGGAAGG - Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134824598 16:17274461-17274483 CAGGGGAAAAGGATATAGGAAGG + Intronic
1134880787 16:17743802-17743824 ATGAGGAGAAGCAGACAGGGAGG + Intergenic
1135031841 16:19044857-19044879 GGGGAGAGAAGGAGAGAGGATGG - Intronic
1135168743 16:20164604-20164626 ATGGGGAGGAGGAGAGAAGAGGG - Intergenic
1135183172 16:20292381-20292403 CTGGGGAGCAGGGGAGAGAATGG - Intergenic
1135585265 16:23665461-23665483 CTGACGAGAAGGAGGCAGCAAGG - Intronic
1135939592 16:26809746-26809768 CAAGGGAGAAGGAGGAAGGAAGG + Intergenic
1136298788 16:29319539-29319561 CGGCGGAGCAGGTGACAGGATGG - Intergenic
1136395122 16:29988327-29988349 GTGGGGGGAAGGGGACAGGTTGG - Exonic
1136604657 16:31325238-31325260 GTGGGAAGAAGAAGACAGGCCGG - Intronic
1137363336 16:47840158-47840180 CTGGGGAGGAGGGGAGAGGTCGG - Intergenic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137715887 16:50598097-50598119 TTGGGGACAAGGGGACAGAAGGG + Intronic
1137927604 16:52555434-52555456 ATAGGGGGAAGGAGACAGGCTGG + Intergenic
1138486681 16:57349768-57349790 GAGGGAAGAAGGAGGCAGGAAGG - Intergenic
1138532055 16:57639828-57639850 CTGGGGAGAAGGGGAATGCACGG - Intronic
1138612981 16:58142122-58142144 CTGGGAATAAGCAGACAAGATGG - Intergenic
1138668330 16:58592251-58592273 CTGGTGAGGAGCAGACAGCATGG + Intronic
1139052674 16:63145373-63145395 CTTGGGAGACTGAGGCAGGAGGG - Intergenic
1139236314 16:65343300-65343322 CTGGGGACAGGGGAACAGGATGG + Intergenic
1139380722 16:66529099-66529121 CAGGGGAAAAGGAGACAGCCAGG + Intronic
1139435107 16:66932415-66932437 CTGGGAAGGAGGTGACAGGAGGG - Intronic
1139639668 16:68281991-68282013 CTGGGAAGGATGAGACTGGAGGG + Intronic
1139665059 16:68449205-68449227 ATGGGAAGACGGAGACGGGAAGG - Intergenic
1139696435 16:68678586-68678608 CTGTAGAGAAGGAGACAGGCTGG + Exonic
1140092547 16:71850213-71850235 GTTGGCAGAAGGAGATAGGAGGG - Exonic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140223947 16:73064172-73064194 CTGGGGGGCAGGAGGCAGGTGGG + Intergenic
1140225097 16:73070778-73070800 CTGGAGAGAGGCAGAGAGGATGG - Intergenic
1140329542 16:74040591-74040613 CTGGTGGGAAGAAGAAAGGAGGG + Intergenic
1140435499 16:74943644-74943666 AAGGGCAGGAGGAGACAGGAAGG - Intronic
1140699868 16:77572148-77572170 CTGGGTGGAGGGTGACAGGAGGG - Intergenic
1141259492 16:82439879-82439901 TGGTGGAAAAGGAGACAGGAAGG - Intergenic
1141436871 16:84004611-84004633 GTGGGGAGATGGAGACAGAGAGG + Intergenic
1141481042 16:84307097-84307119 CTGGAGAGAATGAGTAAGGAGGG + Intronic
1141527146 16:84618586-84618608 TTGGGGAGAAGGAAATAGGGAGG - Intergenic
1141691436 16:85598970-85598992 AGGGGGAGTAGGAGAGAGGAGGG - Intergenic
1141752409 16:85967682-85967704 CCTGGGAGAAGCAGCCAGGATGG + Intergenic
1141775581 16:86120950-86120972 GTGGGGAGAAAGAGAGAGGGAGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1141909738 16:87050490-87050512 CTGGGGAGAACGAGAAAGGAAGG - Intergenic
1142026271 16:87815676-87815698 CTGGGGTCAAGGTGACAGCAAGG - Intergenic
1142060456 16:88026037-88026059 CGGCGGAGCAGGTGACAGGAGGG - Intronic
1142112458 16:88339715-88339737 AAGGGGATGAGGAGACAGGATGG + Intergenic
1142145887 16:88492823-88492845 CTTGGGAGAAGGAGAGGGGCTGG - Intronic
1142237145 16:88927703-88927725 CTGGGGAGGAGGAGGCGGAAGGG - Intronic
1142403334 16:89872665-89872687 TTGGGGACATGGGGACAGGAGGG - Intergenic
1142453212 16:90196951-90196973 CTGGGGAGACTAATACAGGAGGG + Intergenic
1142529689 17:571526-571548 GTGGGGAGAGGGAGACCGTAGGG - Intronic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142617028 17:1142718-1142740 CTGGGGAAGAGAAGACAAGACGG + Intronic
1142642004 17:1289637-1289659 CTGGGGAGAAGAAGGCTGCAAGG - Intronic
1142906247 17:3044197-3044219 GTGGGGACCAGCAGACAGGAAGG - Intergenic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143197637 17:5088359-5088381 GTGGGGAGGAAGAGACAGGCTGG - Intronic
1143362679 17:6384487-6384509 CTGGAGAGGAGGTGGCAGGAAGG + Intergenic
1143399893 17:6637303-6637325 CTGTGGAGAAGGAGACACGGTGG - Intronic
1143445204 17:7005234-7005256 CTGGAGAGGAGGAGATTGGAGGG - Intronic
1143536526 17:7543699-7543721 GTGGGGAGAAGAGGACAGGAGGG + Intergenic
1143772257 17:9176124-9176146 CTGGGGAGAAGGTGGCAGTTAGG - Intronic
1143789446 17:9281988-9282010 GTGGGGAGAAGGCCCCAGGAGGG - Intronic
1144480482 17:15624957-15624979 CTAGGGAGAATGAGAGAGGACGG + Intronic
1144551455 17:16244780-16244802 CTCGGGAGACTGAGGCAGGAGGG - Intronic
1144702484 17:17348461-17348483 CTGGGGTGATGGAGCCTGGAGGG - Intergenic
1144702498 17:17348500-17348522 CTGGGGTGATGGAGCCTGGAGGG - Intergenic
1144702526 17:17348578-17348600 CTGGGGTGATGGAGCCTGGAAGG - Intergenic
1144843875 17:18205777-18205799 CTGGGGAGAAGTAAGCAGGAGGG - Intronic
1144917828 17:18738788-18738810 CTAGGGAGAATGAGAGAGGACGG - Intergenic
1145857607 17:28177128-28177150 CTGAGGAGGAAGAGAAAGGAGGG + Intronic
1146123890 17:30217305-30217327 CTGGGGTGAAGGAGAAAGAAAGG + Intronic
1146488403 17:33262312-33262334 ATGGGGAGAGGGAGAAAGGGAGG + Intronic
1146529624 17:33597260-33597282 CTGCAGGGAAGGAGACATGATGG + Intronic
1146669903 17:34729918-34729940 CTTGGGAGACTGAGGCAGGAAGG + Intergenic
1146695246 17:34903926-34903948 GTGGGGTGAAGGAGAGAAGATGG + Intergenic
1147044766 17:37744332-37744354 CTGGGGAGAAGAAGCCCGGTGGG + Intronic
1147050403 17:37790082-37790104 GTGGGGAGAAAGAGACAGGGAGG + Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1147588434 17:41666229-41666251 AGGGGGAGCAGGAGAGAGGAAGG - Intergenic
1147632723 17:41942590-41942612 CAGGGGCCAAGGAGACAGGCAGG + Intronic
1147687249 17:42293880-42293902 CTGGGGAGAAGGAACCAAGTGGG + Intronic
1147930810 17:43979568-43979590 CTCAGGAGACTGAGACAGGAGGG + Intronic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148049186 17:44760767-44760789 CTGGGCAGAGGGAGGAAGGAGGG + Intronic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148638259 17:49165627-49165649 GTGGGGGGAAAGAGAGAGGAAGG - Intronic
1148643346 17:49204592-49204614 ATGGTGAGATGGAGTCAGGATGG + Intronic
1148742081 17:49898607-49898629 ATGGGGAGCAGGAGCCAGGCTGG - Intergenic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1148862858 17:50613551-50613573 CTGGGGTGACGGGGAGAGGAGGG + Intronic
1149267308 17:54941013-54941035 CTAGGGAAAAGGAGAGAGGGAGG - Intronic
1149555471 17:57570571-57570593 CTGGGGACAAGAAGGCAGGCAGG - Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1150014272 17:61538050-61538072 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1150293969 17:63998243-63998265 CCGCGGAGGAGGAGACAGGAGGG + Intergenic
1150822354 17:68445749-68445771 CTGGTGAGGAGGTGTCAGGAAGG + Intronic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1151143329 17:72016220-72016242 CTGGGGAAGAGGGGACAGGAAGG + Intergenic
1151214355 17:72567667-72567689 CTCAGTCGAAGGAGACAGGAAGG - Intergenic
1151290839 17:73148705-73148727 AGGGGGAGAAGAAGAGAGGATGG - Intergenic
1151327039 17:73385920-73385942 GTGGAGAGAAGCAGACAGGTGGG + Intronic
1151347565 17:73511535-73511557 CTGGGGAGGAGGAGAGGGAAGGG + Intronic
1151459402 17:74245738-74245760 CGGGTGAGGAGGAGCCAGGAGGG + Intronic
1151516580 17:74600016-74600038 CTGGAGGGAAGGAGACAAGCTGG + Intergenic
1151541872 17:74768705-74768727 TTGGGGAGAAGGAAAAAGGTGGG - Exonic
1152041510 17:77906681-77906703 CTGGGGAGCAGGCCACAGGCAGG - Intergenic
1152085005 17:78212641-78212663 TTGGGGAGAGGGAGAGAGAAAGG + Intergenic
1152224362 17:79085837-79085859 CTGGGGTGGAGGAGTCAGGGAGG + Intronic
1152276030 17:79358052-79358074 CTTGGGAGGCTGAGACAGGAGGG - Intronic
1152713307 17:81885811-81885833 CTGGAGAGAAGGCCCCAGGAAGG - Intergenic
1152945790 17:83196711-83196733 ATGGGGGGAAGAGGACAGGAGGG + Intergenic
1152991220 18:365616-365638 CAAGGAAGAAGGTGACAGGAGGG + Intronic
1153284553 18:3446289-3446311 CTTGGGAGGCTGAGACAGGAGGG - Intronic
1153658128 18:7303492-7303514 CTGGGGAGGAGAAGAGAGGATGG - Intergenic
1153977047 18:10278551-10278573 TTGGGGAGAGGCAGGCAGGAAGG - Intergenic
1153978925 18:10293013-10293035 CAGGAGAGAAGTAGACAGGGTGG - Intergenic
1154024546 18:10695299-10695321 CTGGGGAGAAGAAGGCTGGGAGG + Intronic
1154031245 18:10756062-10756084 ATGGGGATAAGGATAAAGGATGG + Intronic
1154202267 18:12308022-12308044 CTGGCGGGGAGGAGACGGGAAGG - Intronic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1155385751 18:25275642-25275664 ATGGGGAGAAGGAAAGAGGGAGG - Intronic
1155909720 18:31494088-31494110 CTGGGGAGAGGAAGAGAGCATGG + Intergenic
1155998622 18:32359229-32359251 CTAGGGAGAAGGAATCAGGTGGG - Intronic
1156015985 18:32547573-32547595 CTGTGGAGAAGAAAACAGGAGGG - Intergenic
1156202864 18:34854141-34854163 ATGGGGAGTAGGAGAATGGAGGG + Intronic
1156241527 18:35259297-35259319 CTTGGGAGGCTGAGACAGGAGGG - Intronic
1156401550 18:36744614-36744636 GTGGGGAGCAGGAGCCGGGAGGG - Intronic
1156449935 18:37261206-37261228 CTGGGCAGGAGGACACAAGAAGG - Intronic
1156456209 18:37296048-37296070 TGGGGGACAAGGAGAAAGGAAGG - Intronic
1156528859 18:37795749-37795771 CTGAAGAGAAGGAGAAAGCAAGG + Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1156921033 18:42522583-42522605 CTCAGAAGAAGGAGGCAGGAAGG + Intergenic
1156951691 18:42907871-42907893 CTTGGGAGACTGAGTCAGGAGGG + Intronic
1157133621 18:45032656-45032678 TTGGGGAGAGGAACACAGGATGG - Intronic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157535745 18:48456108-48456130 CTGGAGGGAAGAAGAAAGGAAGG + Intergenic
1157587235 18:48811555-48811577 CTGGGGAGCAGGGGACATGGGGG - Intronic
1157805536 18:50655076-50655098 CTGCTGAGAAAGAAACAGGAGGG - Intronic
1158851057 18:61496090-61496112 GAGGAGAGAAGGAGAGAGGAAGG - Intronic
1159015258 18:63097246-63097268 CTGGGGAGGAGTGGAAAGGAAGG - Intergenic
1159217017 18:65405629-65405651 GAGGGGAGAAGGAGGTAGGAGGG + Intergenic
1159262331 18:66030546-66030568 GTGGGGAGAAGGGGACAATAAGG + Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1160270744 18:77381311-77381333 GTGGAGAGAAGGAGGCAAGATGG - Intergenic
1160747125 19:717303-717325 CTGGGGGGAGGGGGACGGGAGGG - Intronic
1161349258 19:3783317-3783339 CCGGGGAGGAGGAGAAAGGCTGG + Intronic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1161735586 19:5990476-5990498 CTGGGGAGTAGCAAAGAGGAAGG + Intergenic
1161766477 19:6211548-6211570 CTGGGGAGGAGGAGACATCTAGG + Intergenic
1161950825 19:7466982-7467004 CTGGGGAGATGGAGACCCGCGGG - Intronic
1161980327 19:7626882-7626904 GTGGGGAGAAGCAGGCAGGGTGG - Intronic
1162142294 19:8592104-8592126 CTGGGTGGGGGGAGACAGGAAGG + Intronic
1162440350 19:10688527-10688549 CTGGGGGAGAGAAGACAGGATGG - Intronic
1162552133 19:11363883-11363905 AGGGGGCCAAGGAGACAGGAAGG + Intronic
1162613811 19:11779209-11779231 CTTGGGAGGCTGAGACAGGAAGG + Intronic
1162706296 19:12557129-12557151 CTGGGTTGATGGAGACAGAAAGG + Intronic
1162964325 19:14148893-14148915 CTGGGGGGAAGGGGACAGGTAGG - Exonic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163161027 19:15464248-15464270 GTGGGGAGAAGGCGGCTGGAGGG - Exonic
1163183363 19:15619340-15619362 ATGGGCAGAAGAAGAAAGGAGGG - Intronic
1163234484 19:16022824-16022846 CTGGGGAGTATGGGGCAGGAGGG - Intergenic
1163495031 19:17641357-17641379 CTGGGGTGCAGGAAACAAGAGGG - Intronic
1163646124 19:18490090-18490112 CAGGAGAGAAGGCGACAGCAGGG - Intronic
1163729676 19:18941596-18941618 CTCCTGAGAAGGTGACAGGAGGG - Intergenic
1163938194 19:20469854-20469876 TTGGGGAGAGGAAGACAGCATGG - Intergenic
1164484929 19:28647203-28647225 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
1164493567 19:28736654-28736676 CTGGGCAGAAGCAGCCAGCATGG - Intergenic
1164675123 19:30095600-30095622 CTGGGAAGCAGGTGCCAGGACGG - Intergenic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1164899474 19:31906179-31906201 GTGGGGCCAAGGAGATAGGAAGG + Intergenic
1165052591 19:33151440-33151462 CTGGGGACAGGCAGGCAGGAGGG + Intronic
1165124672 19:33585398-33585420 CTAGGGAGACTGAGACAGGAGGG + Intergenic
1165333683 19:35154975-35154997 CTGGGGAGACTGAGGCAGGCGGG - Exonic
1165355902 19:35303889-35303911 CAGGGGAAATGGAAACAGGAAGG - Intronic
1165390340 19:35534941-35534963 CTGAGGAAAGGGAGACAGCAGGG - Intronic
1165393573 19:35551717-35551739 GTGGGGGGAAGGAGAGAGGCAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165703226 19:37954490-37954512 CAGTGGGGAAGGAGACAGGCTGG + Intronic
1165704257 19:37964173-37964195 TTTGGGAGGTGGAGACAGGATGG + Intronic
1165797407 19:38526970-38526992 CTGGGGAGACAGAGCCAGGCTGG - Intronic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166130087 19:40740781-40740803 CTGGGAAGCAGGAGGCAGAATGG + Exonic
1166235052 19:41449700-41449722 CTGGTGAGCGGGAGACAGGCAGG + Intergenic
1166589121 19:43980542-43980564 CTGGTGAGAAGGAAGCAGGAAGG + Intronic
1166851581 19:45763948-45763970 CTGGGGAGACGGTGGCAGGATGG - Intronic
1167018135 19:46855178-46855200 CTGGGCAGAAGAACACAGGTAGG + Intergenic
1167074219 19:47239408-47239430 CTGGGGAGAGGGAGTTGGGAAGG + Intergenic
1167241975 19:48349398-48349420 CTTGGGAGAACAAGGCAGGAAGG + Intronic
1167254406 19:48418655-48418677 CGAGGGAGAAGGAGGGAGGAAGG + Intronic
1167327068 19:48833198-48833220 CAGGCAAGCAGGAGACAGGAAGG + Intronic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167511212 19:49896183-49896205 CTGGGGTGGAGGAGAAGGGAGGG + Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167729688 19:51244665-51244687 CTGGGGAAGAGGAGTCAAGATGG - Intergenic
1167768242 19:51498288-51498310 CTGTAGAGAAAGAGACAGAAGGG + Intronic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168104229 19:54156826-54156848 CTGGGGAAGAAGAGACAGCACGG - Exonic
1168323954 19:55528708-55528730 CCGGAGAGAAGGAGAGAGGACGG + Intergenic
1168433796 19:56302283-56302305 GAGGGAAGAAGGAGAGAGGAAGG - Intronic
924991395 2:315808-315830 CAGGGGACCAGAAGACAGGAGGG - Intergenic
925077162 2:1026630-1026652 CTCGGGAGAATGAGACATGCTGG - Intronic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925410129 2:3635081-3635103 CAGGGGAGAGGGGGACAGGCAGG - Intronic
925889954 2:8425578-8425600 TTAGGAGGAAGGAGACAGGATGG + Intergenic
926094991 2:10075399-10075421 CAGGGGACAAGAAGAAAGGATGG - Intronic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926472863 2:13282841-13282863 CTGGGGAGAAACAAATAGGAAGG + Intergenic
926788776 2:16548184-16548206 CTGAGCAGAAGCAGACAGAATGG + Intergenic
926839441 2:17062815-17062837 CTTGTAAGAAGGAGGCAGGAGGG - Intergenic
927307531 2:21590638-21590660 CTGGGGAGCAGAAGAGAGGAAGG - Intergenic
927476835 2:23420147-23420169 CTGGGCAGGAGGGAACAGGAGGG - Intronic
927878164 2:26672643-26672665 CTGGGGAGAGGCAGAAGGGAGGG - Intergenic
928412882 2:31067907-31067929 TTGGGGAGGAGCAGGCAGGAAGG + Intronic
928545779 2:32328012-32328034 CTTGGGAGGATGAGGCAGGAGGG - Intergenic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
929122015 2:38491178-38491200 CTGGGGAGGAGGAGACGTGGGGG - Intergenic
929246973 2:39712720-39712742 CAGGGGAGAAGTGGAAAGGAAGG + Intronic
929284590 2:40121075-40121097 CTAGTGATAAGCAGACAGGAGGG + Intronic
929454489 2:42056177-42056199 CCTGGTAGAAGGAGGCAGGAGGG + Intronic
929484576 2:42342286-42342308 CTAGGGAGAGGGAGAGAGCAGGG - Intronic
929749967 2:44700554-44700576 CTGGGGAGAGGGAGAGAGATGGG + Intronic
929769513 2:44879893-44879915 GTGGGGAGAAGGAGTTAGAAAGG - Intergenic
929786932 2:45000213-45000235 CTGGGGAGACTGAGGCAGGGAGG + Intergenic
930152693 2:48074762-48074784 CAGAGGAGAAAGAGAAAGGATGG - Intergenic
930347705 2:50205940-50205962 CTTGGGAGAAGGAGAGAGAAGGG + Intronic
930834969 2:55783377-55783399 CTGGGTAGAAGGGGGCAGAAAGG + Intergenic
930859596 2:56056676-56056698 CTAGGAAGAAGGTGACAGGTAGG - Intergenic
931648183 2:64444379-64444401 GTGGGGAGCAGGAGAGAGCATGG + Intergenic
931960961 2:67482445-67482467 CCAAGGAGAAGGAGAAAGGAGGG - Intergenic
932278546 2:70470087-70470109 AAGGAGGGAAGGAGACAGGAAGG + Intronic
932369785 2:71177503-71177525 CTGGGGAGAAGGAGAAATGCAGG - Intergenic
932369834 2:71177754-71177776 CTGGGGAGGAGGAGTCAGGAAGG + Intergenic
932396967 2:71455006-71455028 CTGGGGAGAAGGGGAGTGGCAGG - Intronic
932419219 2:71591792-71591814 CTGGAGAGAAGGACACAGACTGG - Intronic
932430667 2:71672064-71672086 CTGGGGAGAAGGTGGCTGGAAGG + Intronic
932433414 2:71688816-71688838 CTGGGGAGAGTGAGCCTGGAGGG + Intergenic
932494603 2:72140168-72140190 CTTGGGAGAAGGACACAGAAAGG + Intronic
932583569 2:73008355-73008377 GCGGGGAGAAGGAGAGGGGAGGG + Intronic
932654866 2:73601658-73601680 CTGGGGACAAGGCCGCAGGAGGG + Intronic
932663013 2:73673272-73673294 CTGGAGACAAGGGCACAGGAGGG + Intergenic
932689749 2:73902214-73902236 CAGGATAGCAGGAGACAGGATGG - Intronic
933230926 2:79806472-79806494 CTGGGAAGAAAGGGAGAGGAAGG + Intronic
933774479 2:85763966-85763988 GAGGGGAGAAGGCGTCAGGAGGG - Intronic
934501763 2:94866854-94866876 GTGGGGAGAGGGAGAGAGGGAGG - Intergenic
934515335 2:94982672-94982694 TGGGGGAGGAGGACACAGGAAGG + Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935720459 2:105974682-105974704 CCGGGGAGAGGGAGAAAAGATGG - Intergenic
935739100 2:106130889-106130911 CTGGGGGGGAGGAGCCAAGATGG + Intronic
935987732 2:108690831-108690853 CTGGGGAGGTTGAGGCAGGAGGG - Intergenic
936126560 2:109793535-109793557 CTGGGGAGGTTGAGGCAGGAGGG - Intronic
936218133 2:110577933-110577955 CTGGGGAGGTTGAGGCAGGAGGG + Intergenic
936278474 2:111119739-111119761 CGCGGGAGGAGCAGACAGGAGGG + Intronic
936480341 2:112879789-112879811 CTGGGGACAGGGTCACAGGATGG - Intergenic
936514754 2:113174508-113174530 CTGGAGAGAGGGAGTCTGGAAGG + Intronic
936532446 2:113285855-113285877 CTGGGGAGAAGGGGCAATGAGGG + Intergenic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
937304892 2:120865124-120865146 CTGGGGAGCCCGAGCCAGGAGGG + Intronic
937759317 2:125581407-125581429 CTGGGAAGAAGGAGACATTTAGG - Intergenic
937916891 2:127103678-127103700 CTGGGGAGAAGGACAGCTGAGGG - Intronic
938238117 2:129722789-129722811 CTGGCTAGAGGGAGACGGGAAGG - Intergenic
938265313 2:129923835-129923857 CTGGGGAGATTGAGGCAGGTAGG - Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
938692865 2:133808271-133808293 CTGGGGACAAGGGACCAGGAAGG + Intergenic
938822128 2:134969364-134969386 GTGGGGAGAGGGAGACGAGAGGG + Intronic
938936635 2:136133145-136133167 CTTAGGAGGATGAGACAGGAGGG - Intergenic
939448608 2:142341957-142341979 CTGGGGAGAATGAAAAAGGATGG + Intergenic
939570279 2:143832483-143832505 CTGGGGTGAAGGAGGAGGGAAGG + Intergenic
939626586 2:144484675-144484697 CAGTGGAGGAGAAGACAGGAAGG - Intronic
940596040 2:155794803-155794825 CAGGGAAGCAGGAGAGAGGATGG + Intergenic
940965160 2:159828991-159829013 CTGAGGACTAGGAGACAGGGAGG + Intronic
940976967 2:159957213-159957235 CTGGGAAGAAGTAGAAATGAAGG + Intronic
941016418 2:160362490-160362512 TGGAGGAGAAGGAGACAGAAGGG + Intronic
941085421 2:161111917-161111939 CAAGGGAGAACCAGACAGGATGG + Intergenic
941950357 2:171149536-171149558 CTGGGAAGAAAAAGAAAGGAGGG + Intronic
942460355 2:176163926-176163948 CCGGGGAGAAGGCGTCTGGATGG + Intronic
942604876 2:177679968-177679990 CTGGGGAGAGGGCTGCAGGAAGG + Intronic
942641680 2:178067120-178067142 ATGGGCAGAAGGAGACAGATGGG - Intronic
942747788 2:179255106-179255128 CTGAGGAGAAGGAGAGAGACAGG - Intronic
943087404 2:183329259-183329281 CTGAGGAGAGGGAAACAGGTGGG - Intergenic
943137152 2:183928252-183928274 CTGGAGGGAAACAGACAGGAGGG - Intergenic
943732856 2:191321646-191321668 CTGGGAGGAAGCAGACAGCAGGG - Intronic
943945718 2:194060623-194060645 CTTGGGAGAAGGACATAGAAGGG - Intergenic
945256081 2:207804373-207804395 GTGTGCAGAAGGAGACAGGAAGG + Intergenic
945765611 2:213973251-213973273 CTTGGGAGAAAAAGCCAGGAAGG - Intronic
945982194 2:216321628-216321650 CTTGGAAGAAGGAGACCTGAAGG - Intronic
946419075 2:219554746-219554768 CGGGGGAGATGGAGAGAGGGAGG + Intronic
946454162 2:219809413-219809435 CTCAGGAGACTGAGACAGGAGGG + Intergenic
947740369 2:232482090-232482112 CAGGGCTGGAGGAGACAGGAGGG + Intronic
947942414 2:234069743-234069765 CGGGGGAGAAGGAGAGAGAATGG + Intronic
948461654 2:238132627-238132649 CTGGAGGGAGGGATACAGGAAGG + Exonic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948660078 2:239501640-239501662 CTAAGGACAAGGAGACAGGATGG + Intergenic
948879741 2:240850639-240850661 ACGGGGAGATGAAGACAGGATGG + Intergenic
949084651 2:242141609-242141631 CTGGGGAGAGTAATACAGGAGGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168980007 20:1996172-1996194 CTCGGGAAGAGGAGACAGGGAGG - Intergenic
1169013502 20:2271956-2271978 CTGGGGCGCAGGAGAGGGGAGGG + Intergenic
1169207640 20:3749209-3749231 CTGGGGGTCAGGAGACAGCAGGG - Intronic
1169927088 20:10794772-10794794 CTGGGGAGAAGGAGATTGAGAGG - Intergenic
1170038921 20:12019819-12019841 GTGGGGTGGAGGAGTCAGGAAGG - Intergenic
1170172732 20:13433497-13433519 GAGGGTAGAAGGAGACAGTATGG + Intronic
1170403762 20:16014657-16014679 CTGGGGAGCCAGGGACAGGAAGG - Intronic
1170656487 20:18291676-18291698 ATGTGAAGAAGGAGACAGTAGGG - Intronic
1170975167 20:21157014-21157036 CTTGGGAGACTGAGGCAGGAGGG + Intronic
1171865491 20:30485411-30485433 CCGGGGAGACGGAGTCAGCAGGG + Intergenic
1171907198 20:30908814-30908836 TAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1171913053 20:30985452-30985474 ATGGGGAGGAGGAGCCAAGATGG + Intergenic
1171941145 20:31331014-31331036 AGGGGGAGAAGGAGAGAAGAAGG + Intergenic
1171958285 20:31475862-31475884 CTGAGGAGGAAGAGGCAGGAGGG - Intronic
1172128341 20:32638804-32638826 CTGGAGAGAAGCAGAAAGGGGGG + Intergenic
1172270850 20:33655003-33655025 CAGGTGACAGGGAGACAGGAGGG - Intergenic
1172970750 20:38871499-38871521 GTGGGAAGAAGGAGAGAGAAGGG + Intronic
1172972426 20:38883226-38883248 CTGGGGAAACGGAGACAGCCAGG - Intronic
1173019989 20:39259073-39259095 CTAGAGAGCAGGAGACAGGGAGG - Intergenic
1173124055 20:40320467-40320489 CTAGGGAGAAGGAGATGGGCTGG + Intergenic
1173401948 20:42733832-42733854 CTGGGGAGAAGCAGGCACGAGGG + Intronic
1173476467 20:43363363-43363385 CAGGGGCCAGGGAGACAGGAGGG + Intergenic
1173661364 20:44736325-44736347 ATTGGGAGAAGGAGAGAGGAAGG - Intergenic
1173722621 20:45272825-45272847 CTGGGGGGATGGAGAAAGCATGG - Intergenic
1173868251 20:46326562-46326584 CAGGGCAAAAGGAGACTGGAAGG + Intergenic
1173878760 20:46394533-46394555 CTGGGGAGAAAGAATCAGAAAGG + Intronic
1174140359 20:48408798-48408820 TTGGGAAGGAGGAGACAGGCAGG - Intergenic
1174148290 20:48467883-48467905 CTGGCTGGCAGGAGACAGGATGG + Intergenic
1174569366 20:51490710-51490732 CTTGGGAGAGTGAGACAGGAAGG + Intronic
1174607450 20:51771181-51771203 CTGGGGACATGGATATAGGATGG - Intergenic
1174976012 20:55335282-55335304 CTGGGGAAAAGGATATGGGATGG - Intergenic
1175289803 20:57868169-57868191 CTGGGGAGCAGGAGTGAGGGGGG - Intergenic
1175326192 20:58129991-58130013 CAGGGGAGCAGGGGACAGGGTGG - Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175408812 20:58752683-58752705 CTGAGGAGACGGATGCAGGAGGG - Intergenic
1175487392 20:59355740-59355762 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175487401 20:59355761-59355783 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175487409 20:59355781-59355803 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175759028 20:61548793-61548815 ATGAGGAGTTGGAGACAGGAAGG + Intronic
1175903045 20:62367424-62367446 GGGGGGGGAAGGAGAGAGGAGGG + Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1175924777 20:62466321-62466343 CTGGGGAGGAGCGGGCAGGATGG - Intronic
1176087643 20:63305321-63305343 GTGGGGAGGAGGAGCCAAGAGGG + Intronic
1176095778 20:63343713-63343735 CTGGGAAGGAGGGGGCAGGATGG + Intronic
1176186406 20:63782321-63782343 CAGCAGAGAAGGAGGCAGGAGGG + Intronic
1176275345 20:64262949-64262971 CAGGGGAGGAGGACACAGGGTGG - Intronic
1176281228 20:64314110-64314132 CTGGGGAGACTAATACAGGAGGG + Intergenic
1176383004 21:6122743-6122765 CTGGGGTGGAGGCGGCAGGAAGG + Exonic
1177520789 21:22221404-22221426 TTGGGGAAAAAGACACAGGATGG - Intergenic
1177536213 21:22431557-22431579 CTGGGGAGAGAGAGAGATGAGGG - Intergenic
1177788458 21:25696375-25696397 GTGGGGAGACGGAGACAGAGAGG + Intronic
1178040932 21:28640276-28640298 CTGGGGAGATGGAGACACAATGG + Intergenic
1178361029 21:31948616-31948638 GTGGGAAGGAGGAGAGAGGAAGG + Intronic
1178460268 21:32796261-32796283 GTGGGGAGGAGGCGAGAGGAGGG + Intronic
1178519436 21:33275788-33275810 CCGAGGAGAAGGAGAGAGGCAGG + Intronic
1178806904 21:35846825-35846847 ATGGGGAGAAGGGGCCAGGCAGG - Intronic
1178826860 21:36024525-36024547 CTCAGGAGACGGAGGCAGGATGG + Intergenic
1179011292 21:37558116-37558138 CTTGGGAGGCTGAGACAGGAGGG + Intergenic
1179033049 21:37736661-37736683 ATGGGGAGATGGAGAGAGGGAGG + Intronic
1179292778 21:40033158-40033180 CTGGGGGGGAGGAGCCAAGATGG + Intronic
1179308160 21:40173683-40173705 CTGGGGTGGAGGGGAGAGGATGG - Intronic
1179524022 21:41964079-41964101 CTGGGGAGATTTAGAGAGGAAGG - Intergenic
1179740465 21:43415496-43415518 CTGGGGTGGAGGCGGCAGGAAGG - Exonic
1179781235 21:43702278-43702300 ATGGGGAAAAGAAGACAGGGAGG + Intergenic
1179888592 21:44324993-44325015 CTGGGCAGGAGAAGGCAGGAGGG + Intronic
1179898588 21:44377253-44377275 CTGGGCGGATGGACACAGGATGG + Intronic
1180002917 21:45003155-45003177 CTGAGGACAAGGAGACAGCCTGG - Intergenic
1180621881 22:17167800-17167822 CTGGGCAGAAGGAGCCAGCCTGG - Intergenic
1180762351 22:18220020-18220042 CTGGGGTGCCGGGGACAGGAGGG + Intergenic
1180762373 22:18220066-18220088 CTGGGGGGCCGGGGACAGGAGGG + Intergenic
1180773295 22:18404542-18404564 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
1180773317 22:18404588-18404610 CTGGGGTGCCGGGGACAGGAGGG - Intergenic
1180804648 22:18654091-18654113 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
1180804670 22:18654137-18654159 CTGGGGTGCCGGGGACAGGAGGG - Intergenic
1180806078 22:18715273-18715295 CTGGGGTGCCGGGGACAGGAGGG + Intergenic
1180806100 22:18715319-18715341 CTGGGGGGCCGGGGACAGGAGGG + Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181192391 22:21151475-21151497 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
1181192413 22:21151521-21151543 CTGGGGTGCCGGGGACAGGAGGG - Intergenic
1181217026 22:21341054-21341076 CTGGGGTGCCGGGGACAGGAGGG + Intergenic
1181217048 22:21341100-21341122 CTGGGGGGCCGGGGACAGGAGGG + Intergenic
1181387772 22:22558029-22558051 ATGGGGAAAGGGAGACAGGGTGG + Intronic
1181459512 22:23077958-23077980 CTGGGCAGGAGGAGGCATGAGGG - Intronic
1181480760 22:23197868-23197890 CTGGGGAGGGGGTGACAGAAAGG + Intronic
1181735026 22:24874657-24874679 CAAGGGAGATGGAGGCAGGAAGG + Intronic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1181884650 22:26010663-26010685 CTGGGATGAAGGACAGAGGATGG - Intronic
1181908734 22:26220833-26220855 ATTGAGAGAAGGAGAAAGGAAGG + Intronic
1182103481 22:27673011-27673033 ATGAGGAGAAGGAGAAAGAAAGG + Intergenic
1182116788 22:27761337-27761359 AGGGGGAGAAGGAGAGAGGGAGG - Intronic
1182544940 22:31069594-31069616 AGGGAGAGAAGGAGTCAGGAAGG + Intronic
1182744917 22:32598108-32598130 CCGAGGAGAAGGGGTCAGGATGG - Intronic
1182877669 22:33706385-33706407 CTGCAGAGGAGGAAACAGGAAGG + Intronic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1183810663 22:40254410-40254432 CTTGGGAGGCTGAGACAGGAGGG + Intronic
1184039118 22:41932998-41933020 CTGGGGAGAAAAAGTCAGAAGGG + Intergenic
1184247443 22:43242731-43242753 CTGGGGACAGAGAGACTGGAGGG - Intronic
1184254799 22:43280772-43280794 CTGAGGAGGAGATGACAGGAGGG - Intronic
1184254817 22:43280846-43280868 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254847 22:43280967-43280989 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254876 22:43281085-43281107 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254905 22:43281203-43281225 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254935 22:43281324-43281346 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254978 22:43281493-43281515 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254991 22:43281543-43281565 CTGAGGGGGAGGTGACAGGAGGG - Intronic
1184255007 22:43281596-43281618 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184364360 22:44040486-44040508 CTTATGAGAAGGAGGCAGGAGGG + Intronic
1184550111 22:45199972-45199994 ATGGGGAGAAGAAGGCAGGCCGG + Exonic
1185013183 22:48327886-48327908 CTGGGGAGAAGAGGAGAGGGTGG - Intergenic
1185155393 22:49190681-49190703 AGGCAGAGAAGGAGACAGGAAGG + Intergenic
1185220647 22:49627619-49627641 CAGGGCAGCTGGAGACAGGAGGG + Intronic
1185258599 22:49849555-49849577 CTGCGGAGAGGGAGGAAGGAAGG + Intergenic
1185363373 22:50422789-50422811 CTGGGGAGGGTGAGACGGGATGG - Intronic
1203235125 22_KI270731v1_random:145524-145546 CTGGGGGGCCGGGGACAGGAGGG - Intergenic
1203235147 22_KI270731v1_random:145570-145592 CTGGGGTGCCGGGGACAGGAGGG - Intergenic
949738990 3:7208307-7208329 CTGGCCATAAGGAGACAGAAAGG + Intronic
949815058 3:8049393-8049415 CTAGGGAGAGAGAGACAGGCTGG - Intergenic
950325940 3:12110079-12110101 CTGGGGAGGCTGAGACAAGAGGG + Intronic
950579953 3:13855569-13855591 CTGGGGTGCAGGAGACAGCGTGG + Intronic
950611582 3:14130522-14130544 ATGGGGAGAAAGGGACAGGCAGG + Intronic
950678711 3:14570103-14570125 ATGGGGTGAAGGTGAGAGGAAGG + Intergenic
950773205 3:15328630-15328652 CTGGGGAGGATGATGCAGGAGGG + Intronic
950791196 3:15473820-15473842 CTGGGGAGAGGGTGGCAGGATGG - Intronic
951489577 3:23254712-23254734 CTGGGGAGGAGTAGCCAAGAAGG + Intronic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
951909064 3:27730462-27730484 GTGGGGAGGAGGACAAAGGAGGG - Intergenic
952155002 3:30633573-30633595 CAGGGGAGTAGGTGACATGAAGG + Intronic
952494275 3:33902270-33902292 CAGGAGAGTAGGAGACAGGAAGG + Intergenic
952721652 3:36540024-36540046 CTTAGAAGAGGGAGACAGGAGGG + Intronic
952962976 3:38604362-38604384 CAAGGGAGAAGGAGGCAGGAAGG + Intronic
953430496 3:42835878-42835900 GTGGGCAGAAGGAGGAAGGAGGG - Intronic
953493217 3:43366679-43366701 CTGGGAAGGAGCAGACAGGGTGG + Exonic
953671205 3:44963806-44963828 CCGGGGTGAAGGAGACAGGGAGG - Intronic
953676104 3:45003630-45003652 CTGGGTTGGAGGAGCCAGGAAGG - Intronic
953864838 3:46575389-46575411 GTGGGGAGAAGGGGAAGGGAAGG - Intronic
953878012 3:46677266-46677288 CTGGAAAGACGGAGACAGAAAGG + Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
953978035 3:47397053-47397075 CTGAGGAGAGGGAGAGAGGCAGG + Intronic
953997801 3:47534091-47534113 CTGGGGAGGAGGAGCCAGGCTGG + Intergenic
954746226 3:52789064-52789086 AGGGAGGGAAGGAGACAGGAGGG - Intronic
955340230 3:58119740-58119762 CTAGGGAGAAGGAGAGGTGAGGG - Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
955543075 3:59998752-59998774 CTGTAGGGAAGGGGACAGGAAGG - Intronic
956622360 3:71234082-71234104 TTGGGGAGATGGAGGCAGAAGGG + Intronic
956726191 3:72158438-72158460 ATGGAGAGAGAGAGACAGGAAGG + Intergenic
956903339 3:73740004-73740026 CTGTGGAGTAGGAGACAGTATGG + Intergenic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957192292 3:77025054-77025076 CAGGAGACAAGGAGACAGGGTGG + Intronic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957792651 3:84959751-84959773 CTGGGGACAGGGAGACTGGGAGG - Intronic
958006465 3:87818479-87818501 CTGGGGAGCAGTAGAAATGATGG + Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
960717344 3:120589804-120589826 TTGGTGAGAAGGTGAGAGGAAGG + Intergenic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
960970130 3:123133555-123133577 ATGGGGAGAATCAGACAGGATGG + Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961007597 3:123415257-123415279 CTGGGGACCAGGGGACAGGGTGG + Intronic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961439618 3:126945113-126945135 CTGGGGAGAAGAGGCCAGGTAGG + Intronic
961455925 3:127023883-127023905 CTGGGGAGAAGGCCCCAGGTGGG + Intronic
961587994 3:127950283-127950305 GTGGGAAGAAGGAGATAGAAGGG + Intronic
961613149 3:128156789-128156811 CTGAGGAGAGGGAGACAGACAGG - Intronic
961664891 3:128488869-128488891 CTGGGGAGACGGAGGCTCGAAGG + Intronic
962321726 3:134396161-134396183 CAGGAGACAAAGAGACAGGAAGG - Intergenic
962383358 3:134914048-134914070 CTGTGGAGAATGTGACTGGATGG + Intronic
962469647 3:135694749-135694771 CTGGTGGGAAGGAGTCTGGAAGG - Intergenic
962743644 3:138381670-138381692 CTGGGGAGTCGGAGACAGAGAGG - Intronic
962991432 3:140580894-140580916 GTGGGGAGAAGGAACCAGAATGG + Intergenic
963530662 3:146469820-146469842 ATGGGGAGAGGGAGACGGGACGG - Intronic
963821539 3:149900464-149900486 CTTGGGAGGCTGAGACAGGAGGG + Intronic
963894130 3:150667254-150667276 CTGGGATGAAGGAGTCTGGAAGG + Intronic
963956565 3:151260928-151260950 CTGGGGAGATGGAAACTGGAAGG - Intronic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
964741594 3:159971818-159971840 ATGGGGAGAACGACACAGAATGG + Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
965520201 3:169662946-169662968 CTGGGGGGAAGGGGAGGGGAGGG + Intronic
966261300 3:177982616-177982638 ATTGGGAGAAGGAGCCAGGAAGG - Intergenic
966444569 3:179987309-179987331 ATGGGGAGAGGGAGAGAGGGAGG - Intronic
966921407 3:184613932-184613954 CTGGGGGGAAGAAAACAGGGCGG - Intronic
967356497 3:188577871-188577893 GTGGGGAGAGGAAGACAGAAGGG - Intronic
967389893 3:188945348-188945370 GTGGGGAGAAGGGTTCAGGATGG - Intergenic
967577330 3:191108817-191108839 ATGGGGAGAAAGAGAGAGAAGGG - Intergenic
967901116 3:194453205-194453227 CTTGGGAGGCTGAGACAGGAGGG + Intronic
968057295 3:195701979-195702001 CTGGGGTGGACGGGACAGGAGGG + Intergenic
968078223 3:195828787-195828809 CAGGGAGGAAGGAGGCAGGAAGG + Intergenic
968231094 3:197004983-197005005 CTGTGGGGAAGATGACAGGAAGG + Intronic
968266643 3:197368050-197368072 GTGGAGTGAAGGAGACAGAAAGG - Intergenic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
968824818 4:2887455-2887477 CTGGGGGGAGGGGGACAAGACGG + Intronic
968908574 4:3465457-3465479 CTGGTGTGAGGGAGAGAGGAAGG + Intronic
969403988 4:6977087-6977109 GTGGGGAGAGGGAGACAGTGGGG - Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969576285 4:8037975-8037997 CCAGGGAGAAGGGGACAGGCAGG - Intronic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969871362 4:10107053-10107075 ATGGGGAAAACGAGACAGGGAGG + Intronic
969939476 4:10716468-10716490 GTGGGGAGAAGGTGACAGACTGG + Intergenic
970580289 4:17468645-17468667 GTGAGGGGAAGAAGACAGGAAGG + Intronic
970820787 4:20210054-20210076 AAGGGGAGAGGGAGACAGGCAGG + Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972622254 4:40758775-40758797 CTTGGGAGACTGAGGCAGGAGGG + Intronic
972732342 4:41807290-41807312 CTGGGGAGTTGGGGACAGGGAGG + Intergenic
972944491 4:44237323-44237345 ATGGGAAGAAAGAGAGAGGAAGG - Intronic
973312430 4:48724018-48724040 CTTGGGAGGTTGAGACAGGAGGG + Intronic
973976324 4:56266437-56266459 GTGGGAAGAAGGGGACAGGAGGG - Intronic
974123858 4:57671696-57671718 CTGTGGAGAAGGAGGCATGTAGG + Intergenic
974611701 4:64226900-64226922 CTAGGGAGAAGGACAGAGAAAGG - Intergenic
975681921 4:76885829-76885851 CTGGTCAGGAGGAGACACGAAGG - Intergenic
975684447 4:76905741-76905763 ATGGGGAGGAGGGAACAGGATGG + Intergenic
975714099 4:77189185-77189207 CTGTGGAGGAGGAAACAGGGAGG - Intronic
975865675 4:78721354-78721376 CTGAGGGGAAGGAAACAGAAAGG - Intergenic
975929879 4:79507062-79507084 CTGGGGAGAGGGAAAAAGAATGG - Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976579691 4:86721676-86721698 CGGGGGAGAGGGAGAGGGGAAGG - Intronic
976602057 4:86946807-86946829 CAGGAGAAAAGGAGACAGGTTGG - Intronic
977066606 4:92324309-92324331 CTGGGGACAGAGAGAAAGGATGG - Intronic
977169028 4:93737480-93737502 TTGGGGAGGATGAGACAGGAGGG + Intronic
977797115 4:101179545-101179567 CTGGGGACAAAGAGACAGCATGG - Intronic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979481093 4:121218589-121218611 ACGGGGAGAAGGAGGAAGGAAGG - Intronic
980884999 4:138752640-138752662 CTGGGGTGGAGGAGGAAGGAAGG - Intergenic
980967996 4:139542233-139542255 CTGGGGAGTAGAAGGCAGGAGGG + Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981545853 4:145892416-145892438 CTTGGAAGAAGGAGAAAGAAAGG + Intronic
981579308 4:146236262-146236284 GCTGGGAGAAGGAAACAGGAGGG - Intergenic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981829083 4:148979610-148979632 TTGGGGAGGAGGAGAAAGGAAGG - Intergenic
981848906 4:149204884-149204906 CTGGAGAGATGAAGACAGAAAGG - Intergenic
982240355 4:153293908-153293930 TTGGGGAGAGGGAGGCAGGGCGG + Intronic
982629063 4:157808596-157808618 TTGGGGAGAAAGACAGAGGAGGG + Intergenic
982775324 4:159435695-159435717 CAGGTGAGAGGGAGAGAGGAAGG + Intergenic
982979336 4:162112348-162112370 CTGGGGAGGCTGAGACAGGAGGG - Intronic
983472801 4:168177129-168177151 GTGGGGAGAAGGAGGTAGGGAGG - Intronic
983559150 4:169083941-169083963 CTGGGGAGCGGAAGAGAGGAGGG + Intergenic
984065100 4:175037922-175037944 CTCGGGAGAAGGACAGAGAAAGG + Intergenic
984077077 4:175196820-175196842 CTAGGAAGAAGGAAACTGGAAGG - Intergenic
984926516 4:184811940-184811962 ACTGGGAGGAGGAGACAGGAGGG + Intronic
984995162 4:185423827-185423849 CACGAGAGAAAGAGACAGGAAGG + Intronic
985007735 4:185550906-185550928 CTGAGGAGCAGATGACAGGATGG - Intergenic
985102340 4:186470865-186470887 AAGGGGAAAAGGAGGCAGGAGGG + Intronic
985793083 5:1942178-1942200 CTGGGGAGTAGGAGAAGGAATGG - Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
985936614 5:3102384-3102406 CTAGGGAAGAGGAGACAGGAGGG + Intergenic
986352168 5:6890737-6890759 GTGAAGAGAGGGAGACAGGAAGG - Intergenic
987038623 5:14041265-14041287 CTGGGGACCATGAGGCAGGAAGG - Intergenic
987058637 5:14220344-14220366 CTGAGGAGAGGGAGAGAGGCGGG - Intronic
987399846 5:17463837-17463859 CTGGAGCCAAGGAGACTGGACGG - Intergenic
987595152 5:19988358-19988380 GGGGGGAGAAGGAGGCAGAAGGG - Intronic
988004343 5:25388461-25388483 CTGGTTAGAGGGAGAAAGGAAGG - Intergenic
988080238 5:26404908-26404930 CCGGGGAGAAAGATGCAGGATGG + Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
988655521 5:33207306-33207328 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
988669768 5:33368837-33368859 CTGAGGAGAGGGAGAGAGAAAGG + Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
989272588 5:39550466-39550488 CTGTGGAGAATAAAACAGGAGGG + Intergenic
989348223 5:40453749-40453771 CTGGAGCCAAGGAGACTGGATGG - Intergenic
989550864 5:42734711-42734733 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
991094483 5:62724939-62724961 CTTGGGAGAAGAAGACATGAAGG - Intergenic
991197484 5:63953396-63953418 CTGGAGACAAGGAGACCAGATGG - Intergenic
991576725 5:68112264-68112286 CTGGGGCGAAGAAGAGAGGCAGG + Intergenic
991946172 5:71900405-71900427 CTGGGGAAAAGAAGGCAGGGTGG - Intergenic
992140359 5:73790484-73790506 CTGGGGAGAAGAAACCAAGATGG - Intronic
992199572 5:74370164-74370186 CTGGGGATAAAGGGACAAGATGG + Intergenic
992370483 5:76138682-76138704 CTGGGCAGGAGGATACAGTAGGG - Intronic
992738426 5:79747067-79747089 TTAGGGAGAAAGAGAGAGGAAGG - Intronic
994438463 5:99769224-99769246 CTTGGGAGAAGGACAGAGAAGGG + Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
995134741 5:108668954-108668976 CTGGGGAGATGGAGAAAATATGG - Intergenic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
996022872 5:118611119-118611141 CTTGGGATTAGGAGGCAGGAGGG - Intergenic
996214507 5:120850347-120850369 CTGGGGAGGGTGAGGCAGGAGGG + Intergenic
996873301 5:128215619-128215641 CTATGGAAAAGGAGACAGCAGGG + Intergenic
997167380 5:131675723-131675745 TTGGGGAGAAGGAGATGGGGAGG + Intronic
997286963 5:132686912-132686934 CTAGGAAGAAGTTGACAGGATGG - Intergenic
997671511 5:135678872-135678894 CTGGGGACAAGGACATAGGGTGG + Intergenic
997678995 5:135736069-135736091 CTGGGGAGGAGGGGAGAGGTCGG + Intergenic
997979633 5:138460830-138460852 CTGGGGAAAATGAGGCTGGAAGG - Intergenic
998142064 5:139705656-139705678 CTGGGGGGAAAGAGAGGGGAGGG - Intergenic
998162262 5:139820232-139820254 CTGGGGAGTAGGAGTTGGGATGG + Intronic
998175943 5:139902188-139902210 CTGGGGAGAAGGGGAAATGGGGG + Intronic
998299696 5:141005837-141005859 CTTGGGAGGCTGAGACAGGAGGG + Intronic
998394543 5:141810216-141810238 GAGGGGAGAAGGAGAAAGAAGGG - Intergenic
998400285 5:141845274-141845296 TTGGGGAGAAAGAGAGAGTAGGG - Intergenic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999606797 5:153325323-153325345 CCGGGGGGAAGGAGCCAAGATGG + Intergenic
999615937 5:153424184-153424206 CTGGGGGAAATGAGACAGGAGGG + Intergenic
1000205017 5:159050534-159050556 CAGGGGAGCTGGAGAAAGGAGGG - Intronic
1000230114 5:159307925-159307947 CTTAGGAGAAGGAAACAGGGAGG + Intergenic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1000882192 5:166711198-166711220 CTGGGGAGCAGGGGAAAGCAGGG - Intergenic
1000885524 5:166743749-166743771 ATGGAGAGAAGGAGTCAGGGGGG + Intergenic
1001134108 5:169088355-169088377 CAGGGGAGTAGGAGGCAGTACGG - Intronic
1001213404 5:169832419-169832441 GTGGGGAGAAGCAGAGATGATGG + Intronic
1001301247 5:170535311-170535333 CTTGGGTGAAGGAAAAAGGAGGG + Intronic
1001346559 5:170905567-170905589 CTGGGGTGGAGGACTCAGGAAGG - Intronic
1001404434 5:171465933-171465955 CTTGGGAGCTGGAGGCAGGAAGG + Intergenic
1001634857 5:173202628-173202650 CTGGGGACAGGGTGACACGAAGG + Intergenic
1001868336 5:175125685-175125707 CAGGGGTGAAGGAGAGGGGAAGG - Intergenic
1001959403 5:175871329-175871351 GGAGGGAGAAGGAGACGGGAGGG + Intronic
1002046048 5:176542452-176542474 TTGGGGAGGAGGAGTCAGAAAGG - Intergenic
1002294513 5:178222859-178222881 CTTGGGAGAAGTAGCCAGCAGGG + Exonic
1002384631 5:178857219-178857241 CTTGGGAGGCTGAGACAGGAGGG - Intergenic
1003106753 6:3222577-3222599 CTGGTGAGAAGGGGACAGGCAGG - Intergenic
1003307277 6:4940944-4940966 TTGGGGAGAAGGAGGCAGCAGGG - Intronic
1003334929 6:5161792-5161814 CTGAGGAGAAGGAAAGACGAAGG + Intronic
1003380406 6:5619801-5619823 ATGAAGAGAGGGAGACAGGAAGG - Intronic
1003423070 6:5975299-5975321 TTAGGGAAAAGGAGTCAGGATGG + Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003625007 6:7733498-7733520 CTAGGGAGGGGGGGACAGGATGG - Intronic
1003647372 6:7924709-7924731 CTGGGGAGAAGGCAAGAGCATGG + Intronic
1003939943 6:11014552-11014574 ATGGGGAGAAGGAAAAGGGAGGG - Intronic
1003940425 6:11019666-11019688 ATGGGGAGAAGGAAAAGGGAGGG + Intronic
1004329471 6:14708385-14708407 ATTGGGAGAAGGAGAAAGGCCGG - Intergenic
1004513664 6:16303418-16303440 CTGGAGGGAAGGAGCCAGGAGGG - Exonic
1004560901 6:16749628-16749650 CTGGGGTGAAGGAGGCTGGGTGG - Intronic
1004954840 6:20717884-20717906 CAGTAGAGAAGGAGAAAGGATGG + Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005340376 6:24838309-24838331 CTGGGTTGAAGGAAACATGAAGG + Intronic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005851674 6:29827813-29827835 CTGGGGAGAATGAGTCCGGGTGG - Exonic
1005861899 6:29908308-29908330 CTGGAGAGAGGGAGCCCGGAGGG + Intergenic
1005877498 6:30023344-30023366 CTGGGGAGGAGGAGAGAGTGAGG - Intergenic
1006104837 6:31710329-31710351 CTGGGGAGAAGGAGCCATCAGGG - Intronic
1006404005 6:33833558-33833580 GTGGGGAGAGGGAGACGAGAGGG + Intergenic
1006425573 6:33960879-33960901 ATGTGGGGAGGGAGACAGGAGGG - Intergenic
1006580358 6:35073520-35073542 CTGAGGAAGAGGGGACAGGAGGG - Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1007036405 6:38678467-38678489 CTGGGGAGAATGGGTGAGGATGG + Intronic
1007106683 6:39288206-39288228 CGGGAAAGAAGGAGACAGAAAGG + Intergenic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007210399 6:40189325-40189347 CTGGGCATAGGGACACAGGATGG + Intergenic
1007221675 6:40283738-40283760 CTTGGAAGAAGGTGACATGAGGG - Intergenic
1007275840 6:40673046-40673068 ATGGAGAGAAGGAGAAAGGAAGG - Intergenic
1007358764 6:41340989-41341011 GTGGGGAGAAGGGGAAAGAAGGG - Intronic
1007400578 6:41600195-41600217 CCTGGGGGAAGGAGAAAGGAGGG + Exonic
1007409563 6:41653978-41654000 CTGGGGTGGAGGAGAGAGGCAGG - Exonic
1007709465 6:43812923-43812945 CTTGGGAGGCTGAGACAGGAGGG - Intergenic
1008046787 6:46859358-46859380 TTTGGGAGAAGGACAAAGGAGGG + Exonic
1008976181 6:57429718-57429740 ATTGGGAGACAGAGACAGGAGGG + Intronic
1009164706 6:60326858-60326880 ATTGGGAGACAGAGACAGGAGGG + Intergenic
1010046232 6:71447308-71447330 CTGGGGAGAAGGGGCAGGGAGGG + Intergenic
1010363210 6:75018864-75018886 GTGAGGAGAGGGAGGCAGGATGG - Intergenic
1011315610 6:86027497-86027519 TTGGGGGGAAGGAGCCAAGATGG - Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012396273 6:98801075-98801097 AAGGGGACTAGGAGACAGGAAGG + Intergenic
1012434812 6:99204278-99204300 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1012549450 6:100454011-100454033 CTGCTGAGAAGCTGACAGGACGG - Intronic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1012923416 6:105243947-105243969 AGGGGAAGAAGGAGAAAGGATGG - Intergenic
1013173533 6:107658438-107658460 CTGGGGAGAAGCAGAGATGGTGG - Exonic
1013914693 6:115321382-115321404 CTGGAGTGAAGGTGATAGGAAGG + Intergenic
1014499367 6:122165840-122165862 CTGGTGGGAAGGGGCCAGGAAGG - Intergenic
1015314526 6:131803631-131803653 TTAGGGAAAAGGAGTCAGGATGG - Intergenic
1015394594 6:132720068-132720090 CTGGGGAAAAGGTGACATGGTGG + Intergenic
1015399542 6:132773359-132773381 CTGGTGAGAAGAAGCCAGGTTGG - Intronic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015891742 6:137976698-137976720 CTGGGATGAAGGGGACAGGAAGG - Intergenic
1016014322 6:139168064-139168086 TTGGTGGGAAGGAGACAGGTGGG - Intronic
1016070515 6:139733067-139733089 ATGGGGAGAGGGAAGCAGGAAGG + Intergenic
1016124014 6:140376598-140376620 AGGGGGAGAAAGAGAAAGGAAGG - Intergenic
1016393333 6:143597002-143597024 CAGGAGGGAAGGAGGCAGGAGGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016927514 6:149366587-149366609 CTTGGAAGAAGGAAACAGCAAGG - Intronic
1017493238 6:154962347-154962369 CAGGGTAGAAGGAGAGAGGGAGG + Intronic
1017944260 6:159080799-159080821 CTGGGGAAGACCAGACAGGAAGG - Intergenic
1017979766 6:159390507-159390529 CTGGGGAGAATGAGAAATGCTGG + Intergenic
1018205609 6:161434918-161434940 CTGGGAGGAAGGAGAGGGGAGGG + Intronic
1018355475 6:163010756-163010778 CTGGGCAGAAGGAGACCCCAGGG + Intronic
1018950859 6:168378020-168378042 CTGTGGAGAAGGAGAAACGGGGG - Intergenic
1019018418 6:168897339-168897361 CTGTGGAGAAAGAGACAGAGAGG - Intergenic
1019080707 6:169427683-169427705 CTGGGGTGAAGGGCACAGGTGGG - Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019414107 7:919700-919722 CAGGGGAGAAAGAGACAGGTGGG + Intronic
1019494925 7:1333366-1333388 AGGGGGAGGAGGAGAGAGGAGGG - Intergenic
1019516973 7:1444478-1444500 ATGGGGAGGAGGAGCCAGGGTGG - Intronic
1019644561 7:2122014-2122036 GTGGGGAGGGGGAGACTGGAGGG + Intronic
1019680566 7:2346336-2346358 CTGGGGAGGCCGAAACAGGAGGG + Intronic
1019690552 7:2408581-2408603 CTGGGTGGCAGGAGACGGGAGGG + Intronic
1020106419 7:5424169-5424191 GGGAGGAGAAGGAGAAAGGAGGG - Intronic
1020688906 7:11330253-11330275 CTGGGGCAAATGAGAGAGGAGGG - Intergenic
1020738408 7:11982946-11982968 CTACAGGGAAGGAGACAGGAAGG - Intergenic
1021054783 7:16034470-16034492 CTGGAGGGAAGGTGACAGGAGGG + Intergenic
1021672641 7:23047363-23047385 ATGGGGAGAGGGAGACGAGAGGG + Intergenic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1021955607 7:25821377-25821399 ATGGGGAGAAGGGGACAAAAGGG + Intergenic
1022424267 7:30253173-30253195 GTGGGCAGAAGGAGAAGGGAGGG - Intergenic
1022437343 7:30401878-30401900 GTGGGGAGAAGAAGAGAAGAGGG - Intronic
1022520790 7:31005656-31005678 CTGGGAGGAAGGAGACAGGAAGG + Intergenic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1022809762 7:33857318-33857340 TTGAGGAAAAGGAAACAGGAGGG + Intergenic
1022991751 7:35715188-35715210 CAGGATAGAAGGAGACAGGCAGG + Intergenic
1023092997 7:36633620-36633642 ATGGAAGGAAGGAGACAGGACGG + Intronic
1023131954 7:37012295-37012317 CCAGGGAGAAGGTGACAGGGAGG + Intronic
1023340504 7:39214321-39214343 CAGGGGAGGAGGAGGAAGGAAGG - Intronic
1023961188 7:44927721-44927743 CTGGGGAGATTGAGACAGGCTGG + Intergenic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024054336 7:45649991-45650013 CTGGGCAGAAGCAGGAAGGAAGG + Intronic
1024557118 7:50613394-50613416 CTCTGGAGAATGAGACAGAAGGG + Intronic
1024776116 7:52788183-52788205 CTAGGAAGAATGAAACAGGACGG - Intergenic
1025235814 7:57234272-57234294 CTGGGGGGACGCAGGCAGGAGGG + Intergenic
1025736109 7:64148249-64148271 CTGTGGGGAAAGAGACAGCAGGG + Intronic
1026224019 7:68425038-68425060 ATTGGGAGACTGAGACAGGAGGG + Intergenic
1026445440 7:70480683-70480705 CTGTGTGGCAGGAGACAGGAAGG + Intronic
1026560583 7:71444993-71445015 CTGGAGGGAAAGTGACAGGAGGG + Intronic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1026796048 7:73366753-73366775 CTCGGGAGGCTGAGACAGGAGGG + Intergenic
1026865604 7:73822386-73822408 CTGGGGAGCAGGAGGCAGGGTGG - Intronic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1026955054 7:74371755-74371777 GGGAGGAGAAGGAGAGAGGAGGG + Intronic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1027151743 7:75738587-75738609 CTGGGGAGAAGGGCAGAGGCGGG - Intronic
1027437823 7:78183675-78183697 CTTGGGAGACCGAGACAAGACGG - Intronic
1027481935 7:78708963-78708985 ATGGAGAGAAGGAGACAGATTGG - Intronic
1027487851 7:78784349-78784371 ATGAGGAGCAAGAGACAGGAGGG - Intronic
1027798383 7:82721118-82721140 CTTGGTAGAATGAAACAGGATGG - Intergenic
1027900666 7:84110261-84110283 CTAGGGAGCAGGAGGAAGGAAGG - Intronic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028405635 7:90470817-90470839 GTTGGGAGAAGGGGCCAGGATGG - Intronic
1028620381 7:92820318-92820340 CTGGAGAGAAGGAAACATAAGGG + Intronic
1028772884 7:94647372-94647394 ATGGGGAGATGAAGATAGGAGGG - Intronic
1028916986 7:96269955-96269977 CTTGGGGGAAGGGGACAGTATGG + Intronic
1029263672 7:99322250-99322272 TTAGGGAAAAGGAGTCAGGATGG + Intergenic
1029282456 7:99444879-99444901 CCGGGGAGAAGGAGGTGGGAGGG - Intronic
1029592575 7:101517108-101517130 GATGGGTGAAGGAGACAGGAAGG - Intronic
1029612447 7:101634318-101634340 CTGGGGAGGAGGGGACACCAGGG - Intergenic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030351571 7:108494367-108494389 CTGGGGACCATTAGACAGGAGGG - Intronic
1030614859 7:111728726-111728748 CCGGGGAGAAGGAAACGAGAGGG + Intronic
1030658176 7:112191196-112191218 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1031083313 7:117278754-117278776 GTAGGGAGAAGGAGCCAGGATGG - Intronic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032504544 7:132425494-132425516 AAGGGGAGGAGGAGCCAGGAGGG - Intronic
1032657990 7:133952642-133952664 CTGGAGGGAAGGAGAAATGAGGG - Intronic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034027457 7:147721680-147721702 ATGGGGCAAAGGAGCCAGGAAGG - Intronic
1034395629 7:150822529-150822551 CTGGAGAGAGGGAGAAAGGGAGG + Intergenic
1034433517 7:151052322-151052344 CTGAGGAGAAACAGGCAGGAGGG + Intronic
1034541629 7:151762194-151762216 GTGGGGAGAAGACGAGAGGAAGG + Intronic
1034563911 7:151898673-151898695 CTGCTGAGAAGGATCCAGGAGGG - Intergenic
1034859134 7:154581328-154581350 GTGGGGAAAAGGAGACAGAGGGG + Intronic
1035094936 7:156346427-156346449 GCAGGGAGAAGGAGAGAGGATGG + Intergenic
1035120233 7:156560626-156560648 CGGAGGAGATGGAGACAGGGAGG - Intergenic
1035237668 7:157509201-157509223 GGGGAGAGAAGGAGAGAGGAGGG + Intergenic
1035237692 7:157509271-157509293 ATGGGGAGAAGGAGAGAGGGGGG + Intergenic
1035283013 7:157788982-157789004 CTTGGGAAATGGAGGCAGGAAGG - Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035545372 8:478187-478209 CTGGGCAGGAGGGGAGAGGAGGG - Intergenic
1036022544 8:4862127-4862149 CTGGGGACAAGGAGGCATCAGGG + Intronic
1036665380 8:10734034-10734056 CTGGGGGGAAGGGGAGAGGGAGG + Intronic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1037506828 8:19538933-19538955 CAGAAGAGAAGGAGCCAGGAGGG - Intronic
1037540924 8:19870276-19870298 CTGGAGAGCAGGAGATGGGAAGG + Intergenic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1037707591 8:21328248-21328270 CTTGGGAGACTGAGGCAGGAGGG + Intergenic
1037719257 8:21429104-21429126 CTTGGAAGAAGGAATCAGGAAGG + Intergenic
1037728898 8:21506960-21506982 CTCTGGAGAGGGAGAAAGGAGGG + Intergenic
1037749110 8:21668466-21668488 CGAGGGAGAATGAGACCGGAAGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038027278 8:23602925-23602947 CTGGGGAGAAGTTGCCACGATGG - Intergenic
1038164382 8:25071154-25071176 CTGGGTAGAAAGAGACCAGAAGG + Intergenic
1038314595 8:26473022-26473044 CTTGGGGGAAAGAGGCAGGAGGG + Intronic
1038325237 8:26567809-26567831 ATGGGGAGAAGAAGAGATGAAGG + Intronic
1038529807 8:28309261-28309283 CAGGGGAGAAGCAGAAAGAAGGG + Intergenic
1038567822 8:28634544-28634566 ATGGGCAGAAAGAGCCAGGAAGG - Intronic
1038647354 8:29372884-29372906 CCGGGGAGGAGGAGAAGGGAAGG + Intergenic
1039084996 8:33771169-33771191 CTTGGGAGAAGGAAAAAGGTTGG - Intergenic
1039099016 8:33920899-33920921 ATGGGGAGAAGAGGAAAGGAGGG + Intergenic
1040685823 8:49871653-49871675 CTGAGGAGAAGGAGAGATGGGGG + Intergenic
1040829864 8:51664636-51664658 CTGAGCAGTAGGAGACAGGAAGG - Intronic
1040999756 8:53438940-53438962 TTGTGGAGAATGAGAAAGGAAGG - Intergenic
1041213650 8:55578442-55578464 CTGGGGAGGGGGACACAGGGAGG + Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041397031 8:57401919-57401941 CAGGGGAGAATGAGAGATGAGGG + Intergenic
1041526953 8:58817010-58817032 CTGGGGTGACGGGGACAGGCTGG + Intronic
1042091498 8:65164604-65164626 AATGGGAGAAGGAGAAAGGAGGG - Intergenic
1042215046 8:66422921-66422943 AGGGGGACCAGGAGACAGGAGGG - Intergenic
1042281202 8:67058294-67058316 TTGAGGAGAAGGAGATGGGAAGG - Intronic
1042378051 8:68078633-68078655 CTGGAGATAGGGAAACAGGATGG - Intronic
1042750653 8:72154261-72154283 CCAGGGAGGAGGAGGCAGGAAGG - Intergenic
1042804423 8:72756277-72756299 CAGGGTATAGGGAGACAGGAAGG - Intronic
1042943452 8:74130964-74130986 CTGGGGAGATGGAGAGAGTTGGG + Intergenic
1042957478 8:74267309-74267331 CTTGGGTGAAGGAAACAAGAAGG + Intronic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043260497 8:78188519-78188541 GAGGGGAGAAGGAGAAGGGAAGG + Intergenic
1043615998 8:82126405-82126427 GTAGGGAGAATGAGACAGGATGG + Intergenic
1044450776 8:92333962-92333984 CAGGGGAGCAGGAGAAAGAATGG - Intergenic
1044646250 8:94446621-94446643 GTGGGAAATAGGAGACAGGAGGG - Intronic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1045495027 8:102700845-102700867 CTGGGGAGGAGGAGCCTGGCTGG - Intergenic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045648762 8:104324056-104324078 CTGGGAGGAAAGAGACAGGCAGG + Intergenic
1045714239 8:105022779-105022801 CTGGAGGGAAGGAGAGACGAAGG - Intronic
1047177949 8:122559137-122559159 TTGGGGGGAAGGAGACAGGGAGG + Intergenic
1047309909 8:123683241-123683263 TTGTGGAGGAGGAGAAAGGAGGG + Intronic
1047903099 8:129445009-129445031 CAGGGGTGGAGGAGACAGGAGGG + Intergenic
1047991321 8:130289553-130289575 CTGGGGAGGCGAAGACTGGAAGG + Intronic
1048043505 8:130752498-130752520 GTGGGGACAAGGAGTCAGGGTGG + Intergenic
1048072640 8:131039044-131039066 CTCCGGAGCAGGAGACAGAAGGG - Intronic
1048180518 8:132190088-132190110 CATGGGAAAAGGAGACAGGTTGG + Intronic
1048329295 8:133461212-133461234 CTGGGCTGAATGAGACAAGAAGG + Intronic
1048506071 8:135023121-135023143 ATGGGGAGATGAAGACAGGTTGG - Intergenic
1048893210 8:138966079-138966101 CTGGGGAGAGGGGCACATGATGG + Intergenic
1048966899 8:139621688-139621710 CTGGGGAGAAGGACACCATATGG + Intronic
1049218032 8:141416728-141416750 CTGGGGAGCAGAGGACAGGAGGG - Intronic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049370304 8:142261180-142261202 GTGGGAGGAAGGAGAGAGGAAGG + Intronic
1049473167 8:142785209-142785231 CTGGGGGGAAGGTCACAGGCTGG + Exonic
1049679268 8:143910308-143910330 CAGGGGTGAAAGAGAAAGGAGGG - Intergenic
1049927082 9:419968-419990 CAGGGGAGAAGGAAACTGGCTGG - Intronic
1050123921 9:2336858-2336880 CTGGGGAGAAAGAGAGATAATGG + Intergenic
1050707188 9:8414860-8414882 CAGGGGAGCAGGAGAGAGGGAGG + Intronic
1050848772 9:10258014-10258036 GTGGGGAGAAGGGGGCAGGAAGG + Intronic
1051164754 9:14249686-14249708 GAGGGGAGAAGAAGAGAGGAAGG + Intronic
1051634239 9:19167080-19167102 CTGGGGACTATGAGAGAGGAGGG - Intergenic
1053178713 9:35949234-35949256 CTGGGAAGCTAGAGACAGGAAGG - Intergenic
1053401746 9:37830529-37830551 CTGGGGAGGAAGAGAAGGGAAGG + Intronic
1053901001 9:42795535-42795557 TTTGGGAGAAGGACAAAGGAGGG - Intergenic
1054260643 9:62862028-62862050 TTTGGGAGAAGGACAAAGGAGGG + Intergenic
1054916332 9:70498228-70498250 GTGGGGAGGAGGAAACTGGAGGG + Intergenic
1055849944 9:80614840-80614862 GTGTGGAGGGGGAGACAGGAAGG - Intergenic
1055994142 9:82139357-82139379 CGGAGGAGAAGGGAACAGGAAGG + Intergenic
1056106292 9:83349854-83349876 CTGGGGAGTGGGGGCCAGGAGGG + Intronic
1056178927 9:84062663-84062685 CTGGGAAAAAGGAGGCAGGCAGG + Intergenic
1056332712 9:85534882-85534904 GAGAGGAGAAGGAGACAGGCAGG - Intergenic
1056999640 9:91495723-91495745 CAAGGGAGAAGGGGACTGGAGGG + Intergenic
1057004592 9:91546219-91546241 CTTGGGAGGATGAGACAGGAGGG - Intergenic
1057168595 9:92947427-92947449 CGGGAGAGGAGGAGACAGGGCGG + Intergenic
1057351724 9:94304342-94304364 CTGGGGATCAGGGAACAGGAGGG - Intergenic
1057388017 9:94621437-94621459 CTTGGGAGAACAAGGCAGGAAGG + Intronic
1057784399 9:98075481-98075503 AGGGAGGGAAGGAGACAGGAAGG + Intronic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1057849720 9:98556008-98556030 GAGGGGAAAGGGAGACAGGAGGG + Intronic
1057936606 9:99244905-99244927 AAGGGGAGAAGGAGAGAGAAGGG + Intergenic
1057943257 9:99303299-99303321 CTGGGGAGGAGCAGGAAGGATGG + Intergenic
1058025316 9:100136727-100136749 CTGGGGAGATGGGAACAGAAAGG + Intronic
1058051023 9:100406654-100406676 CTGGGGGGAAGATGACAGGAAGG + Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1059218111 9:112585676-112585698 TTGGAGAGGAGGAGACAGGCAGG + Intronic
1059391539 9:114002426-114002448 CTTGGGAGTTGCAGACAGGAGGG + Intronic
1059429268 9:114240411-114240433 CTGGGGAGAAGGGAACAAAAAGG - Intronic
1059750699 9:117244690-117244712 AAGGAGAGAAGGAGAAAGGAAGG + Intronic
1060015577 9:120083514-120083536 CTTGGGCCAAGCAGACAGGATGG + Intergenic
1060146913 9:121260885-121260907 AAGGGGAGGAGGAGAAAGGAGGG + Intronic
1060215413 9:121735954-121735976 CAGGGAAGGAGGAGACAGGCTGG - Intronic
1060438532 9:123617091-123617113 CTGGTGAGAAGTAGAAAGTATGG + Intronic
1060636695 9:125204933-125204955 CTTGGGAGATGGAGATGGGAAGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060781214 9:126414652-126414674 CTGAGGAGAAGGAGACTCAAAGG - Intronic
1060982539 9:127802202-127802224 CTGGGAAGAGGGAGAGGGGAAGG + Intronic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061281688 9:129601354-129601376 GGGGGAAGAAGGAGAGAGGAGGG + Intergenic
1061375472 9:130221537-130221559 CTTGGGAGGAGGTGAGAGGATGG - Intronic
1061482987 9:130906351-130906373 CCGGGGAGAGGCAGGCAGGAGGG - Intronic
1061539919 9:131272619-131272641 CTGGGGCAGGGGAGACAGGAAGG + Intronic
1061633670 9:131891103-131891125 TTGGGAAAATGGAGACAGGATGG + Intronic
1061762230 9:132858753-132858775 TTTGGGAGGGGGAGACAGGAGGG + Intronic
1061897682 9:133656942-133656964 CTGGGGAGGAGGTGGCAGGACGG + Intronic
1061943845 9:133897524-133897546 CTGGGCTGGGGGAGACAGGAAGG - Intronic
1062082900 9:134633886-134633908 CTGAGGGGCTGGAGACAGGAGGG - Intergenic
1062158864 9:135068895-135068917 CTGGGGAGGAGCAGCCAGGGAGG + Intergenic
1062205860 9:135336734-135336756 CTGGGGAGAAGGAGCCGTCAGGG + Intergenic
1062230717 9:135480069-135480091 CTGGGGGGTCGGGGACAGGAGGG + Intronic
1062430121 9:136523189-136523211 CTGGAGACAAGGGGACAAGAGGG + Intronic
1062434330 9:136540002-136540024 CTTGGGAGAAGGAGAGGGGCAGG + Intronic
1062482645 9:136759544-136759566 CTGGGGAGACTGAGGCAGGGAGG - Intergenic
1062548942 9:137077293-137077315 CTGGGGGGATGTAGACAGGGCGG + Intergenic
1062632380 9:137470132-137470154 CTTGGGAGGCGGAGGCAGGAGGG - Intronic
1062683735 9:137799227-137799249 CAGGGAAGAAGGGGACAGGGAGG - Intronic
1185721984 X:2389470-2389492 CTTGGGAGAGGGAGACAGGGAGG + Intronic
1186051761 X:5604091-5604113 GTGGGCAGAGGGAGACAGGAGGG + Intergenic
1186394932 X:9198326-9198348 CATGTAAGAAGGAGACAGGAAGG - Intergenic
1186566961 X:10673234-10673256 CAGGTGAGCAGAAGACAGGATGG - Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187311024 X:18142878-18142900 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1187352617 X:18534899-18534921 TTAGGGAGAAGGAGCGAGGAAGG + Intronic
1187554374 X:20338089-20338111 CTGGAAAAAATGAGACAGGAGGG - Intergenic
1187639880 X:21276417-21276439 CTGAGTAGATGGAGCCAGGAAGG + Intergenic
1187916193 X:24154308-24154330 CTGGAGAAAAGAAGACAGGAAGG - Intronic
1187984522 X:24796063-24796085 CTGGAGAGGAGGAGAGAGGTGGG - Intronic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188299295 X:28487744-28487766 CTGGGGAGAATGAGAAGGCATGG - Intergenic
1189003124 X:36966376-36966398 CTAGGGGTAGGGAGACAGGATGG - Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189367821 X:40402797-40402819 AGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1189653695 X:43218289-43218311 CAGGGGAGAAGGACAAGGGAAGG - Intergenic
1190177265 X:48161080-48161102 ATGGGGAGAAGGAGGCAGTGAGG - Intergenic
1190203993 X:48387450-48387472 ATGGGGAGAAGGAGGCAGTGAGG - Intronic
1190206543 X:48407953-48407975 ATGGGGAGAAGGAGGCAGTGAGG + Intronic
1190290774 X:48990797-48990819 ATGGGGTGAGGGAGGCAGGAGGG - Intronic
1190660536 X:52650241-52650263 ATGGGGAGAAGGAGGCAGTGAGG + Intronic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1191095676 X:56670906-56670928 CTGGGGGAGAGAAGACAGGATGG + Intergenic
1191098091 X:56695881-56695903 CAGGGGAGGAGGAGCCAAGATGG + Intergenic
1191125926 X:56953805-56953827 CTGGGGGGGAGGAGCCAAGATGG - Intergenic
1191698979 X:64019268-64019290 CTCGGGAGGAGGAGCCAAGATGG - Intergenic
1191826597 X:65372607-65372629 CAGGAGAGAGGGAGAGAGGAAGG + Intronic
1192047344 X:67689928-67689950 CAGGGGAGAAGATGGCAGGAAGG - Intronic
1192213053 X:69139842-69139864 CTGGGGCAGAGGAGACAGGGAGG + Intergenic
1192338519 X:70241839-70241861 AAGGGGAGAAGGGGACAGGTTGG - Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1192788583 X:74357577-74357599 CTTGGGAGACTGAGGCAGGAGGG + Intergenic
1193303931 X:79926796-79926818 CTTGGGAGGAGGAGCCAAGATGG + Intergenic
1193866784 X:86741742-86741764 GTGGGAAGAAGGAGACAAAAAGG + Intronic
1194255270 X:91627093-91627115 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1194672859 X:96755969-96755991 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1195285277 X:103377074-103377096 CGGAGGAGAAGGAGACTGCAAGG + Exonic
1195620682 X:106951610-106951632 CTTGGGAGGCTGAGACAGGAGGG - Intronic
1195782323 X:108479604-108479626 CTGGGGAAGAGAAGACAGGGTGG + Intronic
1196178743 X:112667939-112667961 CTGGGGAGCAAGAGTCAGGCAGG + Intronic
1197317884 X:124991133-124991155 TTGGGGAGAAGGAGATTGAAAGG + Intergenic
1197357597 X:125455688-125455710 CTAGGGAGGCTGAGACAGGAGGG - Intergenic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1198231439 X:134693231-134693253 CTGGAGAGCTGGAGGCAGGAAGG - Intronic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1200099729 X:153684651-153684673 ATGGGCAGCTGGAGACAGGATGG - Intronic
1200134470 X:153868182-153868204 AGCGGGGGAAGGAGACAGGAGGG - Intronic
1200136747 X:153878947-153878969 CTGGGCAGTCGGAGACAGGCAGG + Intronic
1200375484 X:155775310-155775332 GAGGGGAGAAGGAGAAAGGGAGG - Exonic
1200573998 Y:4866354-4866376 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1200757804 Y:7007556-7007578 CTTGGGAGACTGAGGCAGGAAGG - Intronic
1201014732 Y:9589711-9589733 CTGGGGGGGAGGAGCCAAGATGG + Intergenic
1201145390 Y:11062316-11062338 CTGGGGAGTGGGTGGCAGGAGGG - Intergenic
1201766791 Y:17579926-17579948 CTCGGGAACAGGAGAAAGGAAGG + Intergenic
1201834762 Y:18326059-18326081 CTCGGGAACAGGAGAAAGGAAGG - Intergenic
1202164344 Y:21970373-21970395 CTGGGGTGAAGGAGTCACCAGGG + Intergenic
1202227012 Y:22615999-22616021 CTGGGGTGAAGGAGTCACCAGGG - Intergenic
1202316110 Y:23579655-23579677 CTGGGGTGAAGGAGTCACCAGGG + Intergenic
1202334240 Y:23790034-23790056 CTGGGGTGAAGGAGTCACTAGGG + Intergenic
1202536528 Y:25880025-25880047 CTGGGGTGAAGGAGTCACTAGGG - Intergenic
1202554654 Y:26090411-26090433 CTGGGGTGAAGGAGTCACCAGGG - Intergenic