ID: 1165923799

View in Genome Browser
Species Human (GRCh38)
Location 19:39314799-39314821
Sequence CAACCTGGAGGCCCTGCCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165923799_1165923804 -5 Left 1165923799 19:39314799-39314821 CCCACGGCAGGGCCTCCAGGTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1165923804 19:39314817-39314839 GGTTGTTGTAGGACAGATCCAGG 0: 1
1: 1
2: 1
3: 9
4: 83
1165923799_1165923808 13 Left 1165923799 19:39314799-39314821 CCCACGGCAGGGCCTCCAGGTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1165923808 19:39314835-39314857 CCAGGTCCTCCACGGTGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 130
1165923799_1165923806 8 Left 1165923799 19:39314799-39314821 CCCACGGCAGGGCCTCCAGGTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1165923806 19:39314830-39314852 CAGATCCAGGTCCTCCACGGTGG 0: 1
1: 0
2: 0
3: 12
4: 123
1165923799_1165923809 17 Left 1165923799 19:39314799-39314821 CCCACGGCAGGGCCTCCAGGTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1165923809 19:39314839-39314861 GTCCTCCACGGTGGACAGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 197
1165923799_1165923812 26 Left 1165923799 19:39314799-39314821 CCCACGGCAGGGCCTCCAGGTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1165923812 19:39314848-39314870 GGTGGACAGGAAGGCGTCAAAGG 0: 1
1: 0
2: 2
3: 10
4: 155
1165923799_1165923805 5 Left 1165923799 19:39314799-39314821 CCCACGGCAGGGCCTCCAGGTTG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1165923805 19:39314827-39314849 GGACAGATCCAGGTCCTCCACGG 0: 1
1: 0
2: 4
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165923799 Original CRISPR CAACCTGGAGGCCCTGCCGT GGG (reversed) Exonic
900483581 1:2910910-2910932 CTACCTGGAGCCTCTGACGTGGG + Intergenic
903668228 1:25021006-25021028 CAACATGGAGGCCCTGGGCTGGG - Intergenic
905214023 1:36394051-36394073 GGCCCTGGAGGCCCTGCAGTAGG + Exonic
906078538 1:43069001-43069023 CAAGCCGGAGGCTCTGCCATGGG + Intergenic
907518904 1:55010556-55010578 CAACCCGGAAGCCCTTCCCTAGG - Exonic
908532393 1:65046331-65046353 CAAGCTGGAGGCCATGCCAAAGG + Intergenic
920302551 1:204997701-204997723 GAACCTGGGGGCCCTGCCCAAGG - Intronic
920703844 1:208237486-208237508 CACCCTGGAGTCCTTGCCGTAGG + Intronic
921886693 1:220314281-220314303 GAACCTGGAGGCCTTGGCCTTGG - Intergenic
922775115 1:228210999-228211021 CAACCTGGAGGGGCTGCTGAAGG + Intronic
1063186799 10:3659064-3659086 GGACCTGGAGGCACTGCTGTGGG + Intergenic
1065308330 10:24389859-24389881 CAAGCTGGTGGCCGTGCCCTGGG - Intronic
1067768876 10:49109339-49109361 CAAGCAGGCGGCCCTGCGGTGGG + Intronic
1068943643 10:62706113-62706135 CAACCTTGAAGCCATGCCTTCGG + Intergenic
1071428214 10:85580881-85580903 GAACCTGTAGGCCCTGCCTCAGG + Intergenic
1072206190 10:93207201-93207223 GAACCTGGAGGCCTTGGCCTTGG - Intergenic
1072755557 10:98018587-98018609 CAACCTGGATTCTCTGACGTGGG + Intronic
1076723237 10:132401844-132401866 CAGCCTGGGGGCTCTGCTGTTGG + Intronic
1076765933 10:132633067-132633089 CACCCAGGAGCCCCTGCCCTGGG - Intronic
1076992225 11:281447-281469 GAAGCAGGAGGCCCTGCGGTGGG + Exonic
1077362452 11:2146733-2146755 CTCCCTGCAGGCCCTGTCGTGGG + Exonic
1077507979 11:2940986-2941008 CTTCCAGGAGGCCCTGCTGTTGG + Intergenic
1077869676 11:6251273-6251295 CAACCTGGAAGCCCCGCCAGAGG - Intergenic
1078059770 11:8035625-8035647 CAACCTGCAGGCCCTCCCTGAGG - Intronic
1078375737 11:10791842-10791864 CAAGCTGGAGGCCCTGAGATTGG - Intergenic
1081988790 11:47326463-47326485 CAACCCGAAGGCCCTGCTGCTGG - Intronic
1083193919 11:61071721-61071743 CTATCTGGAGGCCCTGCCATGGG - Intergenic
1083633868 11:64109659-64109681 CAGCCTGGAGGGCCTCCCATGGG + Intronic
1084327579 11:68410687-68410709 CGTCCTGGGGGCCCTGCCTTGGG + Intronic
1085477289 11:76796483-76796505 CAACCTGGTGCCCCTGCCTGAGG + Exonic
1091671917 12:2457985-2458007 CACCCTGGAGGCCCTGGGATGGG + Intronic
1096533121 12:52254301-52254323 CAACGTGGAGGCCCTGACCCAGG - Intronic
1096546579 12:52344298-52344320 CAACCTGGAGCCCCTGTTGCAGG + Intergenic
1100555979 12:95694346-95694368 GAGCCTGGAGGCGCTGCCGAGGG - Intronic
1103272645 12:119686745-119686767 CAACCTAGAGGCTTTGCAGTTGG - Exonic
1103621354 12:122189284-122189306 GAACCTGGAGGGCATGCCCTTGG + Intronic
1104682750 12:130762540-130762562 CAGGCTGGAGGCCCTGCGGAGGG + Intergenic
1104748178 12:131222912-131222934 CCACATGGAGGCACTGCGGTGGG - Intergenic
1104840981 12:131825552-131825574 CTACCTGGTGGCCCTCCCGAGGG + Intergenic
1104843735 12:131836416-131836438 GAACCTGGAGGCCCAGCAGGTGG + Intronic
1104849162 12:131863127-131863149 CAACCGGGACGCCCTGCAGTCGG - Intergenic
1104897691 12:132172358-132172380 CACCCAGGAGGGCCTGACGTGGG + Intergenic
1108737611 13:53301003-53301025 TAAACTGGAGGCCAGGCCGTTGG + Intergenic
1111574938 13:90141657-90141679 CAACCTGGAGGCTCTTCAATAGG + Intergenic
1112616782 13:101014629-101014651 CAAGCTGGAGCCCCTCCCGAAGG - Intergenic
1115664970 14:35535398-35535420 GCACCTGGAGGCCCTGCCTCGGG - Exonic
1117307186 14:54488628-54488650 CAACCAGAAGGACCTGGCGTGGG + Intronic
1119213506 14:72850397-72850419 CAAAATGGAGGCACTGCTGTGGG - Intronic
1121235956 14:92391362-92391384 CACCCTGGAGACCCTGGGGTTGG - Intronic
1122383293 14:101325814-101325836 CAACGTGCACGCCCTGCCTTGGG - Intergenic
1122788919 14:104176300-104176322 CAACCTGGGGTCCGTGCCCTGGG + Exonic
1130713731 15:86310982-86311004 CCTACTGGATGCCCTGCCGTGGG + Intronic
1131509674 15:93042878-93042900 CAGCCTGGAGCCCCAGCTGTTGG - Intronic
1133203774 16:4220584-4220606 CAACTTGGAGGCCCGGCCTGAGG - Intronic
1133232256 16:4372286-4372308 CATGCCGGAGGCCCAGCCGTGGG - Intronic
1133234460 16:4381453-4381475 CAACGTGGAGGCGCTGCGGCTGG + Exonic
1133304160 16:4799595-4799617 CAACGTGGAGGCCCTGGGATTGG + Intronic
1135915739 16:26604046-26604068 CAGGCAGGAGGCCCTGCCCTGGG + Intergenic
1142122416 16:88393469-88393491 CACCCAGGGGGGCCTGCCGTAGG + Intergenic
1142159329 16:88548449-88548471 CAACATGCAGGCCCTGCCCCGGG - Intergenic
1142364827 16:89644721-89644743 GAACGTGGAGACCCTGACGTGGG - Exonic
1142496946 17:310907-310929 CCCCCTGGGGGCCCTGCTGTAGG - Intronic
1142574073 17:894683-894705 GAACCTGGGGGTCCTGCCGGGGG + Intronic
1142807836 17:2380707-2380729 GAACATGGAGGCCCTGCCCGGGG + Exonic
1144960410 17:19041337-19041359 GACCCTGTAGGCCCTGCCTTTGG - Intronic
1144974749 17:19133187-19133209 GACCCTGTAGGCCCTGCCTTTGG + Intronic
1146304668 17:31721854-31721876 CCAGCTGGATGCCCTGCCTTCGG - Intergenic
1148129063 17:45252082-45252104 CAACCCGGATGTCCTTCCGTAGG + Intergenic
1148772630 17:50076076-50076098 CAACCTGGAGACCCTGTGGATGG + Intronic
1151699806 17:75737200-75737222 TCCCCAGGAGGCCCTGCCGTGGG + Intronic
1152195665 17:78916746-78916768 AAGCCTGGAGGCCCGGCAGTGGG - Intronic
1152544150 17:80992297-80992319 CAGCCTGGCGGCCCGTCCGTGGG + Intronic
1155847473 18:30727633-30727655 CAGCCTGGAGGGCCTGACATTGG - Intergenic
1156461204 18:37322318-37322340 CAAGCTGGATGCCCTGGCCTGGG - Intronic
1157749066 18:50161940-50161962 AAAGCTGGTGGCCCTGCCTTTGG - Intronic
1160524780 18:79529114-79529136 CAACCTGAAGGCCATCCCGTCGG + Intronic
1160754582 19:750905-750927 CCACCTGGAGGCCCTGGGGGTGG + Intergenic
1161319640 19:3634958-3634980 CAGCCTGGAATCCCTGACGTGGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162017223 19:7852200-7852222 CTGCCTGGAGGCCCTGCTGCTGG + Intronic
1164536371 19:29088942-29088964 CAACCTCCAGTCCCTGCTGTCGG + Intergenic
1164807428 19:31127784-31127806 CAGTCTGGAAGCCCTGCTGTGGG - Intergenic
1165923799 19:39314799-39314821 CAACCTGGAGGCCCTGCCGTGGG - Exonic
1166204131 19:41257915-41257937 TTACCTGGCGGCCCTGCCTTTGG + Intronic
1167220391 19:48195348-48195370 CGACCTGGTGGCCATGCAGTGGG + Exonic
1168352773 19:55686069-55686091 CAACCTGCAGGCCCTGGCTCTGG - Intronic
925016345 2:527652-527674 CAGCCTGGAGGCCACACCGTGGG + Intergenic
929046377 2:37794473-37794495 CAATCTGAAGGCACTGCCGATGG + Intergenic
929680137 2:43985728-43985750 CAACCTGGATGTCCTTCAGTAGG - Intronic
929977775 2:46652056-46652078 CAACCTAGAGCACCTGCTGTAGG + Intergenic
932220015 2:69991982-69992004 CAACCTGGATGACCACCCGTGGG + Intergenic
932418262 2:71586601-71586623 CAGGCAGGAGGCCCTGCCCTTGG + Intronic
932497780 2:72155238-72155260 GAACCTGGGGGCCCTGCGGGAGG - Intergenic
935482621 2:103612294-103612316 CAACTAGGAAGCCCTGCCATTGG + Intergenic
935657950 2:105441021-105441043 CAGCCTGCAGGCTCTGCCCTGGG - Intergenic
936286835 2:111187589-111187611 CACCTTGAAGGCCCTGCCCTTGG + Intergenic
941580929 2:167294145-167294167 CCACCTGGACGCCGGGCCGTCGG - Intergenic
942250637 2:174044864-174044886 GATCCTGGAGGCCCTTCCATAGG + Intergenic
942678764 2:178455038-178455060 CCACCTGGAGGTGCCGCCGTTGG - Intronic
944316813 2:198293023-198293045 CAACGTGGCGTCCCTGCCTTGGG + Intronic
946432096 2:219631434-219631456 CAAGTTGGTGGCCCTGCCATGGG - Intronic
947723341 2:232382003-232382025 CAACCTGCAGTCCCTGGGGTTGG - Exonic
947911960 2:233807476-233807498 CAAGGTGGAGGTCCTGCTGTTGG + Exonic
1172100036 20:32479845-32479867 CAACCTGGGAGCCCTGCCTCTGG + Intronic
1176044422 20:63084882-63084904 AAACCTGGAGGCTCTGACGCCGG + Intergenic
1178423172 21:32458193-32458215 GAACAAGGAGCCCCTGCCGTGGG - Intronic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1179879178 21:44286347-44286369 GAACCTGGAGGCCATTCCCTTGG - Intronic
1180206421 21:46264169-46264191 CATCCAGGAGGCCCTGCAGAGGG - Exonic
1180877171 22:19179957-19179979 CCCTCTGCAGGCCCTGCCGTGGG - Exonic
1180951858 22:19724038-19724060 CAACCTGACGGCGCTGCCGCCGG + Exonic
1181022384 22:20110224-20110246 CAACCTGTGGGCCCGGCCTTAGG + Exonic
1181052137 22:20242982-20243004 CAGCCTGCAGGCCCTGCTGGGGG + Exonic
1181491060 22:23261033-23261055 CCACCTGGAGGCACTGCTGCTGG + Exonic
1181509262 22:23381755-23381777 AACCCTGCAGCCCCTGCCGTGGG - Intergenic
1183998966 22:41658294-41658316 GAACCTGGAGGCCTTGGCCTTGG + Exonic
954597129 3:51835695-51835717 CAACTTGGAGGGGCTGCCATGGG - Intergenic
961047946 3:123722203-123722225 CATCCAGGATGCCCTGCCGGAGG - Exonic
961270013 3:125681361-125681383 CATCCAGGATGCCCTGCCGGAGG + Intergenic
961522076 3:127472746-127472768 CAACCTGGCCGCCCTCCCGAAGG + Intergenic
968741320 4:2333091-2333113 CCTCCTGGAGGCACTGGCGTGGG - Intronic
968890887 4:3367828-3367850 GAACCCGGAGGCCCTGTTGTTGG + Intronic
969478138 4:7432796-7432818 CAACCTGGAGTCCCTGGGGGTGG - Exonic
969560307 4:7942478-7942500 CCACCTGCAGGCCCTGCAGGAGG + Intergenic
970656312 4:18234444-18234466 CCACCTTGAGGGCCTGCCATTGG - Intergenic
973257528 4:48128314-48128336 CAACCTGGAGCGCCTGGCTTGGG - Intronic
974077970 4:57184903-57184925 GCACCTGGAGGCCCTTCCTTCGG - Intergenic
985647945 5:1093860-1093882 CACCCTGGGGTCCCTGCCATGGG - Intronic
985822040 5:2166988-2167010 GATCCTGGAGGCCCGGCCATAGG - Intergenic
985861531 5:2475449-2475471 CCACCTGGAGGCCCTACCTCAGG + Intergenic
986669923 5:10133736-10133758 CAACCAAGAGGTCCTGCAGTAGG - Intergenic
990023763 5:51160151-51160173 CAGCATGGAGGCCCTGCAGAGGG - Intergenic
992947696 5:81825467-81825489 CACCCTGGGGCCTCTGCCGTAGG + Intergenic
997210666 5:132074943-132074965 CCTGCTGGAGGCCCTGCCGTAGG - Intronic
997385241 5:133467364-133467386 CCTCCTGCAGGCCCAGCCGTGGG - Intronic
997410515 5:133687304-133687326 CAACCTGGCCTCCCTGCCGCTGG - Intergenic
999142759 5:149373484-149373506 CAACCTGGAGGCCTTTCTTTGGG + Intronic
1002578864 5:180195091-180195113 CAAGCTGGGGGCCCTGACCTTGG + Intronic
1004183159 6:13398036-13398058 AAACCTGGAGCCTCTGCCGCTGG + Intronic
1006412491 6:33882517-33882539 CATCCTGGAGCCCCTGCCAGAGG - Intergenic
1006511746 6:34525383-34525405 CAACCTGGGGGTCCAGCAGTTGG - Intronic
1006982105 6:38155003-38155025 CATCCTGGAGGCCCTTCCTAGGG - Intergenic
1007241948 6:40432615-40432637 CAACCTCCATGGCCTGCCGTGGG - Exonic
1007665229 6:43509790-43509812 GTACCCGGAGGCCCAGCCGTGGG - Exonic
1011362158 6:86539106-86539128 CAACCTCAAGGCCCTGAGGTAGG + Intergenic
1014456579 6:121641957-121641979 CATTGTGGAGGACCTGCCGTTGG + Intergenic
1017008726 6:150047331-150047353 ACACCTGGAGGCCCTGGCTTCGG + Intergenic
1017159359 6:151350627-151350649 CAAGCTGGAAGCCCTACCGAAGG + Exonic
1018093829 6:160367649-160367671 CATCCTGGAAGCCCTGCCTTGGG + Intronic
1019164156 6:170087686-170087708 GGACCCGGAGGCCCTGCGGTGGG + Intergenic
1019525214 7:1477654-1477676 CAGCCTGGAGGCCGTGCGGCTGG - Exonic
1024724699 7:52179478-52179500 AAACCTGCAGGCCCTCCTGTGGG - Intergenic
1024923470 7:54586800-54586822 CCTCCTGGAGGACCTGCCGGAGG + Intergenic
1026581491 7:71622197-71622219 CAACATGGCGGCTCTGCCATTGG + Intronic
1027147206 7:75704014-75704036 CAGCATGGAAGCCCTGCCCTGGG + Intronic
1031966224 7:128030322-128030344 CCACCTGGAGGTCCTGCAGTTGG - Exonic
1035555473 8:564323-564345 CAGCCTGCAGGGCCTGCCGCCGG - Intergenic
1038417021 8:27404528-27404550 CAACCTGGAGTCCCTGCTGCGGG - Intronic
1039771262 8:40689194-40689216 CAAGCTGGAGGTCCAGCCCTGGG - Intronic
1041417384 8:57626587-57626609 CAACCTGGAGGCGCTACCAGAGG - Intergenic
1041889713 8:62855627-62855649 GAACCTGGAGGCCTTGGCCTTGG - Intronic
1042804985 8:72761225-72761247 CATCCTGGGGGCCCTGCATTGGG + Intronic
1047521337 8:125597436-125597458 CAACCAGCAGCCCCTGCCATAGG - Intergenic
1053283556 9:36836702-36836724 CACCCTGGTGGCCCTGGCTTGGG + Exonic
1055744345 9:79426664-79426686 CAGTCTGGAGGCCCTGCCCTTGG - Intergenic
1057286824 9:93763453-93763475 CAACCTAGATGCCCTTCAGTAGG + Intergenic
1058948047 9:109877136-109877158 CATCCTGGAAGCCTTGGCGTTGG - Intronic
1059540395 9:115124732-115124754 CAACCTCTAGGCCCTGCCGAGGG - Intergenic
1061486809 9:130924321-130924343 CATCCTGGATGCCCTGCAGAGGG - Exonic
1061952850 9:133945856-133945878 CCACCTGGAGCACCTGCTGTGGG - Intronic
1062184755 9:135211995-135212017 CAAACAGGAGGCCCTGGAGTGGG - Intergenic
1187413315 X:19070008-19070030 CAACCTGTAGACGCTGCTGTGGG + Intronic
1191850308 X:65581302-65581324 CAAGCAGGTGGCCCTGCCCTAGG + Intergenic
1195199055 X:102529759-102529781 CAACCAGGAGGCCCAGTCATAGG + Intergenic
1196730659 X:118938232-118938254 CAACCTGAGGGCCCTGTCTTTGG - Intergenic
1198082951 X:133256232-133256254 CAACCTTCCGGCCCTGCCATCGG + Intergenic
1199506058 X:148562793-148562815 CAAACTGGAGGCCCTGAACTAGG + Intronic
1199681980 X:150231415-150231437 GAACCTGGAGGCCTTGGCCTTGG - Intergenic
1201978459 Y:19880387-19880409 CACCCAGGAGGCACTGCAGTGGG - Intergenic