ID: 1165924705

View in Genome Browser
Species Human (GRCh38)
Location 19:39320103-39320125
Sequence CCCCCCCGCAACCACCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924689_1165924705 11 Left 1165924689 19:39320069-39320091 CCCCTCCATCTGTCCACCTCCTG No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924687_1165924705 13 Left 1165924687 19:39320067-39320089 CCCCCCTCCATCTGTCCACCTCC No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924693_1165924705 6 Left 1165924693 19:39320074-39320096 CCATCTGTCCACCTCCTGGCCGC No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924692_1165924705 9 Left 1165924692 19:39320071-39320093 CCTCCATCTGTCCACCTCCTGGC No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924690_1165924705 10 Left 1165924690 19:39320070-39320092 CCCTCCATCTGTCCACCTCCTGG No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924695_1165924705 -5 Left 1165924695 19:39320085-39320107 CCTCCTGGCCGCCCATCCCCCCC No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924686_1165924705 21 Left 1165924686 19:39320059-39320081 CCTCTCATCCCCCCTCCATCTGT No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924696_1165924705 -8 Left 1165924696 19:39320088-39320110 CCTGGCCGCCCATCCCCCCCCCG No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924688_1165924705 12 Left 1165924688 19:39320068-39320090 CCCCCTCCATCTGTCCACCTCCT No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data
1165924694_1165924705 -2 Left 1165924694 19:39320082-39320104 CCACCTCCTGGCCGCCCATCCCC No data
Right 1165924705 19:39320103-39320125 CCCCCCCGCAACCACCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924705 Original CRISPR CCCCCCCGCAACCACCGGGA AGG Intergenic
No off target data available for this crispr