ID: 1165924838

View in Genome Browser
Species Human (GRCh38)
Location 19:39320632-39320654
Sequence GGCGCCGCACACGCCGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924827_1165924838 8 Left 1165924827 19:39320601-39320623 CCCCGCGCACACCCGATGGCCAC No data
Right 1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG No data
1165924829_1165924838 6 Left 1165924829 19:39320603-39320625 CCGCGCACACCCGATGGCCACAC No data
Right 1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG No data
1165924835_1165924838 -4 Left 1165924835 19:39320613-39320635 CCGATGGCCACACGGGCAGGGCG No data
Right 1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG No data
1165924828_1165924838 7 Left 1165924828 19:39320602-39320624 CCCGCGCACACCCGATGGCCACA No data
Right 1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG No data
1165924834_1165924838 -3 Left 1165924834 19:39320612-39320634 CCCGATGGCCACACGGGCAGGGC No data
Right 1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG No data
1165924824_1165924838 24 Left 1165924824 19:39320585-39320607 CCGGCCGGGCTCGACACCCCGCG No data
Right 1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG No data
1165924825_1165924838 20 Left 1165924825 19:39320589-39320611 CCGGGCTCGACACCCCGCGCACA No data
Right 1165924838 19:39320632-39320654 GGCGCCGCACACGCCGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924838 Original CRISPR GGCGCCGCACACGCCGGCAC CGG Intergenic