ID: 1165924841

View in Genome Browser
Species Human (GRCh38)
Location 19:39320643-39320665
Sequence CGCCGGCACCGGGCACACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924836_1165924841 0 Left 1165924836 19:39320620-39320642 CCACACGGGCAGGGCGCCGCACA No data
Right 1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG No data
1165924827_1165924841 19 Left 1165924827 19:39320601-39320623 CCCCGCGCACACCCGATGGCCAC No data
Right 1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG No data
1165924835_1165924841 7 Left 1165924835 19:39320613-39320635 CCGATGGCCACACGGGCAGGGCG No data
Right 1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG No data
1165924828_1165924841 18 Left 1165924828 19:39320602-39320624 CCCGCGCACACCCGATGGCCACA No data
Right 1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG No data
1165924834_1165924841 8 Left 1165924834 19:39320612-39320634 CCCGATGGCCACACGGGCAGGGC No data
Right 1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG No data
1165924829_1165924841 17 Left 1165924829 19:39320603-39320625 CCGCGCACACCCGATGGCCACAC No data
Right 1165924841 19:39320643-39320665 CGCCGGCACCGGGCACACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924841 Original CRISPR CGCCGGCACCGGGCACACAT AGG Intergenic
No off target data available for this crispr