ID: 1165924877

View in Genome Browser
Species Human (GRCh38)
Location 19:39320783-39320805
Sequence CCCCCCGGGCTGGGTGAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924877_1165924901 27 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924901 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
1165924877_1165924897 22 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924897 19:39320828-39320850 CGCTGCCTCGCTCCGCGCCATGG No data
1165924877_1165924898 25 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924877_1165924899 26 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924899 19:39320832-39320854 GCCTCGCTCCGCGCCATGGTGGG No data
1165924877_1165924884 -10 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924884 19:39320796-39320818 GCCCGGGGGGGCCCCGGGCCCGG 0: 1
1: 0
2: 13
3: 87
4: 828
1165924877_1165924902 28 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924902 19:39320834-39320856 CTCGCTCCGCGCCATGGTGGGGG No data
1165924877_1165924903 29 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924877 Original CRISPR CCCCCCGGGCTGGGTGAGCG CGG (reversed) Intergenic