ID: 1165924882

View in Genome Browser
Species Human (GRCh38)
Location 19:39320792-39320814
Sequence GCCCGGGGCCCCCCCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924882_1165924898 16 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924882_1165924901 18 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924901 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
1165924882_1165924897 13 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924897 19:39320828-39320850 CGCTGCCTCGCTCCGCGCCATGG No data
1165924882_1165924902 19 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924902 19:39320834-39320856 CTCGCTCCGCGCCATGGTGGGGG No data
1165924882_1165924903 20 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924882_1165924904 23 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924904 19:39320838-39320860 CTCCGCGCCATGGTGGGGGGAGG No data
1165924882_1165924908 29 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924908 19:39320844-39320866 GCCATGGTGGGGGGAGGGCCGGG No data
1165924882_1165924907 28 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924907 19:39320843-39320865 CGCCATGGTGGGGGGAGGGCCGG No data
1165924882_1165924899 17 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924899 19:39320832-39320854 GCCTCGCTCCGCGCCATGGTGGG No data
1165924882_1165924910 30 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924910 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
1165924882_1165924905 24 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924905 19:39320839-39320861 TCCGCGCCATGGTGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924882 Original CRISPR GCCCGGGGCCCCCCCGGGCT GGG (reversed) Intergenic