ID: 1165924883

View in Genome Browser
Species Human (GRCh38)
Location 19:39320793-39320815
Sequence GGCCCGGGGCCCCCCCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924883_1165924904 22 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924904 19:39320838-39320860 CTCCGCGCCATGGTGGGGGGAGG No data
1165924883_1165924898 15 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924883_1165924903 19 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924883_1165924899 16 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924899 19:39320832-39320854 GCCTCGCTCCGCGCCATGGTGGG No data
1165924883_1165924911 30 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924911 19:39320846-39320868 CATGGTGGGGGGAGGGCCGGGGG No data
1165924883_1165924905 23 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924905 19:39320839-39320861 TCCGCGCCATGGTGGGGGGAGGG No data
1165924883_1165924901 17 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924901 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
1165924883_1165924902 18 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924902 19:39320834-39320856 CTCGCTCCGCGCCATGGTGGGGG No data
1165924883_1165924908 28 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924908 19:39320844-39320866 GCCATGGTGGGGGGAGGGCCGGG No data
1165924883_1165924897 12 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924897 19:39320828-39320850 CGCTGCCTCGCTCCGCGCCATGG No data
1165924883_1165924907 27 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924907 19:39320843-39320865 CGCCATGGTGGGGGGAGGGCCGG No data
1165924883_1165924910 29 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924910 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924883 Original CRISPR GGCCCGGGGCCCCCCCGGGC TGG (reversed) Intergenic