ID: 1165924889

View in Genome Browser
Species Human (GRCh38)
Location 19:39320809-39320831
Sequence AGCGGCGGCGGGGCCGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924889_1165924910 13 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924910 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
1165924889_1165924915 20 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924915 19:39320852-39320874 GGGGGGAGGGCCGGGGGAGGGGG No data
1165924889_1165924908 12 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924908 19:39320844-39320866 GCCATGGTGGGGGGAGGGCCGGG No data
1165924889_1165924903 3 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924889_1165924914 19 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924914 19:39320851-39320873 TGGGGGGAGGGCCGGGGGAGGGG No data
1165924889_1165924905 7 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924905 19:39320839-39320861 TCCGCGCCATGGTGGGGGGAGGG No data
1165924889_1165924913 18 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924913 19:39320850-39320872 GTGGGGGGAGGGCCGGGGGAGGG No data
1165924889_1165924897 -4 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924897 19:39320828-39320850 CGCTGCCTCGCTCCGCGCCATGG No data
1165924889_1165924912 17 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924889_1165924901 1 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924901 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
1165924889_1165924902 2 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924902 19:39320834-39320856 CTCGCTCCGCGCCATGGTGGGGG No data
1165924889_1165924916 25 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924916 19:39320857-39320879 GAGGGCCGGGGGAGGGGGCGCGG No data
1165924889_1165924898 -1 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924889_1165924904 6 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924904 19:39320838-39320860 CTCCGCGCCATGGTGGGGGGAGG No data
1165924889_1165924899 0 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924899 19:39320832-39320854 GCCTCGCTCCGCGCCATGGTGGG No data
1165924889_1165924911 14 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924911 19:39320846-39320868 CATGGTGGGGGGAGGGCCGGGGG No data
1165924889_1165924907 11 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924907 19:39320843-39320865 CGCCATGGTGGGGGGAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924889 Original CRISPR AGCGGCGGCGGGGCCGGGCC CGG (reversed) Intergenic