ID: 1165924890

View in Genome Browser
Species Human (GRCh38)
Location 19:39320814-39320836
Sequence GAGGCAGCGGCGGCGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924890_1165924905 2 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924905 19:39320839-39320861 TCCGCGCCATGGTGGGGGGAGGG No data
1165924890_1165924914 14 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924914 19:39320851-39320873 TGGGGGGAGGGCCGGGGGAGGGG No data
1165924890_1165924907 6 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924907 19:39320843-39320865 CGCCATGGTGGGGGGAGGGCCGG No data
1165924890_1165924903 -2 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924890_1165924913 13 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924913 19:39320850-39320872 GTGGGGGGAGGGCCGGGGGAGGG No data
1165924890_1165924916 20 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924916 19:39320857-39320879 GAGGGCCGGGGGAGGGGGCGCGG No data
1165924890_1165924919 29 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG No data
1165924890_1165924902 -3 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924902 19:39320834-39320856 CTCGCTCCGCGCCATGGTGGGGG No data
1165924890_1165924910 8 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924910 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
1165924890_1165924899 -5 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924899 19:39320832-39320854 GCCTCGCTCCGCGCCATGGTGGG No data
1165924890_1165924901 -4 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924901 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
1165924890_1165924904 1 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924904 19:39320838-39320860 CTCCGCGCCATGGTGGGGGGAGG No data
1165924890_1165924918 28 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924918 19:39320865-39320887 GGGGAGGGGGCGCGGTGCCGCGG No data
1165924890_1165924915 15 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924915 19:39320852-39320874 GGGGGGAGGGCCGGGGGAGGGGG No data
1165924890_1165924908 7 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924908 19:39320844-39320866 GCCATGGTGGGGGGAGGGCCGGG No data
1165924890_1165924912 12 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924890_1165924897 -9 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924897 19:39320828-39320850 CGCTGCCTCGCTCCGCGCCATGG No data
1165924890_1165924911 9 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924911 19:39320846-39320868 CATGGTGGGGGGAGGGCCGGGGG No data
1165924890_1165924898 -6 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924890_1165924920 30 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924890 Original CRISPR GAGGCAGCGGCGGCGGGGCC GGG (reversed) Intergenic