ID: 1165924895

View in Genome Browser
Species Human (GRCh38)
Location 19:39320824-39320846
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924895_1165924907 -4 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924907 19:39320843-39320865 CGCCATGGTGGGGGGAGGGCCGG No data
1165924895_1165924919 19 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG No data
1165924895_1165924912 2 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924895_1165924914 4 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924914 19:39320851-39320873 TGGGGGGAGGGCCGGGGGAGGGG No data
1165924895_1165924920 20 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924895_1165924918 18 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924918 19:39320865-39320887 GGGGAGGGGGCGCGGTGCCGCGG No data
1165924895_1165924904 -9 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924904 19:39320838-39320860 CTCCGCGCCATGGTGGGGGGAGG No data
1165924895_1165924911 -1 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924911 19:39320846-39320868 CATGGTGGGGGGAGGGCCGGGGG No data
1165924895_1165924908 -3 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924908 19:39320844-39320866 GCCATGGTGGGGGGAGGGCCGGG No data
1165924895_1165924910 -2 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924910 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
1165924895_1165924905 -8 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924905 19:39320839-39320861 TCCGCGCCATGGTGGGGGGAGGG No data
1165924895_1165924913 3 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924913 19:39320850-39320872 GTGGGGGGAGGGCCGGGGGAGGG No data
1165924895_1165924916 10 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924916 19:39320857-39320879 GAGGGCCGGGGGAGGGGGCGCGG No data
1165924895_1165924915 5 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924915 19:39320852-39320874 GGGGGGAGGGCCGGGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924895 Original CRISPR GGCGCGGAGCGAGGCAGCGG CGG (reversed) Intergenic