ID: 1165924898

View in Genome Browser
Species Human (GRCh38)
Location 19:39320831-39320853
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924888_1165924898 0 Left 1165924888 19:39320808-39320830 CCCGGGCCCGGCCCCGCCGCCGC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924891_1165924898 -7 Left 1165924891 19:39320815-39320837 CCGGCCCCGCCGCCGCTGCCTCG No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924886_1165924898 10 Left 1165924886 19:39320798-39320820 CCGGGGGGGCCCCGGGCCCGGCC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924885_1165924898 11 Left 1165924885 19:39320797-39320819 CCCGGGGGGGCCCCGGGCCCGGC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924890_1165924898 -6 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924877_1165924898 25 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924887_1165924898 1 Left 1165924887 19:39320807-39320829 CCCCGGGCCCGGCCCCGCCGCCG No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924883_1165924898 15 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924889_1165924898 -1 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data
1165924882_1165924898 16 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924898 19:39320831-39320853 TGCCTCGCTCCGCGCCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924898 Original CRISPR TGCCTCGCTCCGCGCCATGG TGG Intergenic