ID: 1165924900

View in Genome Browser
Species Human (GRCh38)
Location 19:39320833-39320855
Sequence CCCCACCATGGCGCGGAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924900_1165924916 1 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924916 19:39320857-39320879 GAGGGCCGGGGGAGGGGGCGCGG No data
1165924900_1165924920 11 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924900_1165924915 -4 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924915 19:39320852-39320874 GGGGGGAGGGCCGGGGGAGGGGG No data
1165924900_1165924919 10 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG No data
1165924900_1165924914 -5 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924914 19:39320851-39320873 TGGGGGGAGGGCCGGGGGAGGGG No data
1165924900_1165924911 -10 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924911 19:39320846-39320868 CATGGTGGGGGGAGGGCCGGGGG No data
1165924900_1165924918 9 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924918 19:39320865-39320887 GGGGAGGGGGCGCGGTGCCGCGG No data
1165924900_1165924912 -7 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924900_1165924913 -6 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924913 19:39320850-39320872 GTGGGGGGAGGGCCGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924900 Original CRISPR CCCCACCATGGCGCGGAGCG AGG (reversed) Intergenic