ID: 1165924903

View in Genome Browser
Species Human (GRCh38)
Location 19:39320835-39320857
Sequence TCGCTCCGCGCCATGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924893_1165924903 -8 Left 1165924893 19:39320820-39320842 CCCGCCGCCGCTGCCTCGCTCCG No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924877_1165924903 29 Left 1165924877 19:39320783-39320805 CCGCGCTCACCCAGCCCGGGGGG No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924882_1165924903 20 Left 1165924882 19:39320792-39320814 CCCAGCCCGGGGGGGCCCCGGGC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924885_1165924903 15 Left 1165924885 19:39320797-39320819 CCCGGGGGGGCCCCGGGCCCGGC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924894_1165924903 -9 Left 1165924894 19:39320821-39320843 CCGCCGCCGCTGCCTCGCTCCGC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924890_1165924903 -2 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924889_1165924903 3 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924892_1165924903 -7 Left 1165924892 19:39320819-39320841 CCCCGCCGCCGCTGCCTCGCTCC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924886_1165924903 14 Left 1165924886 19:39320798-39320820 CCGGGGGGGCCCCGGGCCCGGCC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924888_1165924903 4 Left 1165924888 19:39320808-39320830 CCCGGGCCCGGCCCCGCCGCCGC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924883_1165924903 19 Left 1165924883 19:39320793-39320815 CCAGCCCGGGGGGGCCCCGGGCC No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924887_1165924903 5 Left 1165924887 19:39320807-39320829 CCCCGGGCCCGGCCCCGCCGCCG No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data
1165924891_1165924903 -3 Left 1165924891 19:39320815-39320837 CCGGCCCCGCCGCCGCTGCCTCG No data
Right 1165924903 19:39320835-39320857 TCGCTCCGCGCCATGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924903 Original CRISPR TCGCTCCGCGCCATGGTGGG GGG Intergenic