ID: 1165924906

View in Genome Browser
Species Human (GRCh38)
Location 19:39320840-39320862
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924906_1165924916 -6 Left 1165924906 19:39320840-39320862 CCGCGCCATGGTGGGGGGAGGGC No data
Right 1165924916 19:39320857-39320879 GAGGGCCGGGGGAGGGGGCGCGG No data
1165924906_1165924919 3 Left 1165924906 19:39320840-39320862 CCGCGCCATGGTGGGGGGAGGGC No data
Right 1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG No data
1165924906_1165924920 4 Left 1165924906 19:39320840-39320862 CCGCGCCATGGTGGGGGGAGGGC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924906_1165924918 2 Left 1165924906 19:39320840-39320862 CCGCGCCATGGTGGGGGGAGGGC No data
Right 1165924918 19:39320865-39320887 GGGGAGGGGGCGCGGTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924906 Original CRISPR GCCCTCCCCCCACCATGGCG CGG (reversed) Intergenic