ID: 1165924909

View in Genome Browser
Species Human (GRCh38)
Location 19:39320845-39320867
Sequence CCCCGGCCCTCCCCCCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924909_1165924919 -2 Left 1165924909 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
Right 1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG No data
1165924909_1165924920 -1 Left 1165924909 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924909_1165924918 -3 Left 1165924909 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
Right 1165924918 19:39320865-39320887 GGGGAGGGGGCGCGGTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924909 Original CRISPR CCCCGGCCCTCCCCCCACCA TGG (reversed) Intergenic