ID: 1165924912

View in Genome Browser
Species Human (GRCh38)
Location 19:39320849-39320871
Sequence GGTGGGGGGAGGGCCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924891_1165924912 11 Left 1165924891 19:39320815-39320837 CCGGCCCCGCCGCCGCTGCCTCG No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924895_1165924912 2 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924890_1165924912 12 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924886_1165924912 28 Left 1165924886 19:39320798-39320820 CCGGGGGGGCCCCGGGCCCGGCC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924900_1165924912 -7 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924896_1165924912 -1 Left 1165924896 19:39320827-39320849 CCGCTGCCTCGCTCCGCGCCATG No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924888_1165924912 18 Left 1165924888 19:39320808-39320830 CCCGGGCCCGGCCCCGCCGCCGC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924885_1165924912 29 Left 1165924885 19:39320797-39320819 CCCGGGGGGGCCCCGGGCCCGGC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924894_1165924912 5 Left 1165924894 19:39320821-39320843 CCGCCGCCGCTGCCTCGCTCCGC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924887_1165924912 19 Left 1165924887 19:39320807-39320829 CCCCGGGCCCGGCCCCGCCGCCG No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924893_1165924912 6 Left 1165924893 19:39320820-39320842 CCCGCCGCCGCTGCCTCGCTCCG No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924892_1165924912 7 Left 1165924892 19:39320819-39320841 CCCCGCCGCCGCTGCCTCGCTCC No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data
1165924889_1165924912 17 Left 1165924889 19:39320809-39320831 CCGGGCCCGGCCCCGCCGCCGCT No data
Right 1165924912 19:39320849-39320871 GGTGGGGGGAGGGCCGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924912 Original CRISPR GGTGGGGGGAGGGCCGGGGG AGG Intergenic