ID: 1165924920

View in Genome Browser
Species Human (GRCh38)
Location 19:39320867-39320889
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165924909_1165924920 -1 Left 1165924909 19:39320845-39320867 CCATGGTGGGGGGAGGGCCGGGG No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924906_1165924920 4 Left 1165924906 19:39320840-39320862 CCGCGCCATGGTGGGGGGAGGGC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924900_1165924920 11 Left 1165924900 19:39320833-39320855 CCTCGCTCCGCGCCATGGTGGGG No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924890_1165924920 30 Left 1165924890 19:39320814-39320836 CCCGGCCCCGCCGCCGCTGCCTC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924892_1165924920 25 Left 1165924892 19:39320819-39320841 CCCCGCCGCCGCTGCCTCGCTCC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924895_1165924920 20 Left 1165924895 19:39320824-39320846 CCGCCGCTGCCTCGCTCCGCGCC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924894_1165924920 23 Left 1165924894 19:39320821-39320843 CCGCCGCCGCTGCCTCGCTCCGC No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924893_1165924920 24 Left 1165924893 19:39320820-39320842 CCCGCCGCCGCTGCCTCGCTCCG No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924891_1165924920 29 Left 1165924891 19:39320815-39320837 CCGGCCCCGCCGCCGCTGCCTCG No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data
1165924896_1165924920 17 Left 1165924896 19:39320827-39320849 CCGCTGCCTCGCTCCGCGCCATG No data
Right 1165924920 19:39320867-39320889 GGAGGGGGCGCGGTGCCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165924920 Original CRISPR GGAGGGGGCGCGGTGCCGCG GGG Intergenic