ID: 1165926091

View in Genome Browser
Species Human (GRCh38)
Location 19:39327208-39327230
Sequence AGGAAAACAGCACTAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165926080_1165926091 27 Left 1165926080 19:39327158-39327180 CCTTCAGGGACTGGGCCTGTGAT No data
Right 1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG No data
1165926085_1165926091 12 Left 1165926085 19:39327173-39327195 CCTGTGATCAGAGGGAGGGACAG No data
Right 1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165926091 Original CRISPR AGGAAAACAGCACTAGTGGA GGG Intergenic
No off target data available for this crispr