ID: 1165928477

View in Genome Browser
Species Human (GRCh38)
Location 19:39342065-39342087
Sequence GAGCCTGCCCCCTGCGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165928467_1165928477 28 Left 1165928467 19:39342014-39342036 CCTGAATCAGGAACTGTGACTTC No data
Right 1165928477 19:39342065-39342087 GAGCCTGCCCCCTGCGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165928477 Original CRISPR GAGCCTGCCCCCTGCGGGCC TGG Intronic