ID: 1165928697

View in Genome Browser
Species Human (GRCh38)
Location 19:39342687-39342709
Sequence CCGCCCGCCGCCGCCGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2016
Summary {0: 1, 1: 5, 2: 20, 3: 175, 4: 1815}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165928697_1165928704 -2 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928704 19:39342708-39342730 GGGTGCGGAACGCGGGCCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 124
1165928697_1165928707 1 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928707 19:39342711-39342733 TGCGGAACGCGGGCCTCGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1165928697_1165928711 14 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928711 19:39342724-39342746 CCTCGGGGGGCCGGGCCCCACGG 0: 1
1: 0
2: 0
3: 22
4: 222
1165928697_1165928712 15 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928712 19:39342725-39342747 CTCGGGGGGCCGGGCCCCACGGG 0: 1
1: 0
2: 1
3: 23
4: 170
1165928697_1165928702 -9 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928702 19:39342701-39342723 GGCGGGCGGGTGCGGAACGCGGG 0: 1
1: 0
2: 0
3: 21
4: 212
1165928697_1165928708 5 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928708 19:39342715-39342737 GAACGCGGGCCTCGGGGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 193
1165928697_1165928706 0 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928706 19:39342710-39342732 GTGCGGAACGCGGGCCTCGGGGG 0: 1
1: 0
2: 1
3: 3
4: 70
1165928697_1165928701 -10 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928701 19:39342700-39342722 CGGCGGGCGGGTGCGGAACGCGG 0: 1
1: 0
2: 1
3: 13
4: 194
1165928697_1165928703 -3 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928703 19:39342707-39342729 CGGGTGCGGAACGCGGGCCTCGG 0: 1
1: 0
2: 2
3: 10
4: 95
1165928697_1165928709 6 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928709 19:39342716-39342738 AACGCGGGCCTCGGGGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 133
1165928697_1165928705 -1 Left 1165928697 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG 0: 1
1: 5
2: 20
3: 175
4: 1815
Right 1165928705 19:39342709-39342731 GGTGCGGAACGCGGGCCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165928697 Original CRISPR CCGCCCGCCGCCGCCGCCCG CGG (reversed) Intronic
Too many off-targets to display for this crispr