ID: 1165929160

View in Genome Browser
Species Human (GRCh38)
Location 19:39344853-39344875
Sequence AAGGGTCTCTTGATCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165929160_1165929163 0 Left 1165929160 19:39344853-39344875 CCTTCAGAGATCAAGAGACCCTT 0: 1
1: 1
2: 0
3: 17
4: 459
Right 1165929163 19:39344876-39344898 AACACCCTCCTTAGAGACTTAGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165929160 Original CRISPR AAGGGTCTCTTGATCTCTGA AGG (reversed) Intronic
900122446 1:1054586-1054608 AAGGGTCTCATGATATCCGAGGG + Intronic
900749531 1:4386206-4386228 ATGAGTCTCATGATATCTGAAGG + Intergenic
900817476 1:4859527-4859549 ATAGGTCTCATGATATCTGATGG + Intergenic
901464385 1:9411975-9411997 ATGGGTCTCATGAGATCTGATGG + Intergenic
903125779 1:21246744-21246766 AAGGATCTCTTGAGCTCAGGAGG - Intronic
903566837 1:24274181-24274203 AAGTGTCTGTTGATCCCTGCTGG + Intergenic
905643391 1:39607648-39607670 GAGGATCTCTTGAGCTCTGGAGG + Intergenic
906763850 1:48408797-48408819 ATGGGTCTCATGAGATCTGATGG - Intronic
907099899 1:51821446-51821468 AATGGTCTCTTTAACTCTGAAGG + Intronic
909054358 1:70804710-70804732 ATGGGTCTCATGACATCTGATGG + Intergenic
909104388 1:71390937-71390959 ATGGGTCTCATGAGATCTGATGG + Intergenic
909105319 1:71398872-71398894 ATGGGTCTCATGAGATCTGATGG + Exonic
909241559 1:73220893-73220915 GAGAGTCTCATGATATCTGATGG - Intergenic
910309225 1:85804655-85804677 ATGGGTCTCATGAGATCTGATGG - Intronic
910565313 1:88636808-88636830 ATGGGTCTCATGAGATCTGATGG + Intergenic
910606989 1:89097813-89097835 ATGGGTCTCATGAAATCTGATGG + Intergenic
911127910 1:94358428-94358450 CAGGGCCCCTGGATCTCTGAAGG - Intergenic
911686397 1:100781787-100781809 ATGGGTCTCATGAGATCTGATGG - Intergenic
912147408 1:106810012-106810034 ATGGGTCTCATGATATCTGATGG + Intergenic
912609338 1:111027662-111027684 ATGGGTCTCATGAGATCTGATGG + Intergenic
912722617 1:112032840-112032862 AATGGGCTCTGGATCCCTGATGG - Intergenic
913262855 1:117016374-117016396 AAGATTGTCTTGAACTCTGAAGG + Intronic
913453372 1:119007649-119007671 GAGGGTGTCTTGTTCTTTGACGG + Intergenic
918079356 1:181193793-181193815 ATGGGTCTCATGAGATCTGATGG + Intergenic
918079628 1:181195729-181195751 ATGGGTCTCGTGAGATCTGATGG + Intergenic
918886729 1:190202677-190202699 ATGGGTCTCATGAGATCTGATGG + Intronic
920964015 1:210687408-210687430 ATGGGTCTCTGGATCTGTGCAGG + Intronic
921918433 1:220640216-220640238 AATGGTCCCTTGCTTTCTGATGG + Intronic
922115199 1:222606871-222606893 ATGGGTCTCATGAGATCTGATGG - Intergenic
922548558 1:226476682-226476704 AAGGGTTTTGTGATCTCTGCAGG - Intergenic
922709856 1:227818586-227818608 AAAGATCTCTTGATCCCAGAAGG + Intronic
922956755 1:229608912-229608934 GAGGATCACTTGATCTCAGAAGG + Intronic
923397870 1:233584720-233584742 AAGAATCACTTGAACTCTGAAGG + Intergenic
923695411 1:236245076-236245098 AAGGATCACTTGATCCCAGAAGG - Intronic
923977910 1:239285559-239285581 ATGGGTCTCATGAGATCTGATGG - Intergenic
1064365360 10:14702803-14702825 CAGTGTCTGTTGATCTTTGAGGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064709362 10:18108048-18108070 AAGAGTCTCTTGAACCCTGGAGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067095285 10:43295501-43295523 AAGGCCCTCTTCATCCCTGAAGG - Intergenic
1067134672 10:43597367-43597389 GAGGGTCTCTTGAGCTCAGGAGG - Intergenic
1068055809 10:52011862-52011884 ATGGATCTCATGATATCTGATGG + Intronic
1068264147 10:54625513-54625535 ATGGGTCTCCTGAGATCTGATGG + Intronic
1068469217 10:57439066-57439088 AAGTGTCTCTTGAACTCCTATGG - Intergenic
1068559398 10:58496422-58496444 ATGGGTCTCATGAGATCTGATGG + Intergenic
1068747621 10:60552872-60552894 ATGGGTCTCATGAGATCTGAAGG + Intronic
1069155996 10:65031934-65031956 ATGGGTCTCATGAATTCTGATGG - Intergenic
1069539935 10:69286403-69286425 GAGGATCACTTGAGCTCTGAAGG + Intronic
1070181756 10:74020749-74020771 AAGGGTCACTTGAGCCCTGGAGG + Intronic
1070246668 10:74738683-74738705 GAGGGTCTCTTGAGCTTGGAAGG + Intergenic
1072066100 10:91872987-91873009 GAGGGTCACTTGAGCCCTGAAGG + Intergenic
1072843393 10:98800277-98800299 GAGGCTCTCTTGATCCCAGAAGG + Intronic
1072852787 10:98914177-98914199 ATGGGTCTCATGAGATCTGATGG + Intronic
1075571109 10:123546425-123546447 ATGGGTCTCATGAGATCTGATGG + Intergenic
1076225563 10:128772154-128772176 ATGGGTCTCATGAGATCTGATGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077719564 11:4614128-4614150 ATAGGTCTCTGGGTCTCTGAAGG - Intergenic
1078256406 11:9662981-9663003 AATGGTCACTTGATCTCTTTGGG - Intergenic
1078260377 11:9701259-9701281 AAGAGTCGCTTGAACTCAGAAGG - Intronic
1083120250 11:60505260-60505282 ATGGGTCTCATGAGATCTGATGG - Intronic
1083848546 11:65351850-65351872 AAGGTTCTCTGGATTTGTGAAGG - Exonic
1084180038 11:67441610-67441632 ACGGGTCTCTCCAACTCTGAGGG + Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084628028 11:70323871-70323893 GAGGGTCACTTGAGCTCTGGAGG + Intronic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086334718 11:85788587-85788609 AAGGGTCTCTGGAACCCAGAAGG - Intronic
1087226487 11:95606580-95606602 ATGGGTCTCATGAGATCTGATGG - Intergenic
1087255413 11:95947835-95947857 ATGGGTCTCATGAGATCTGATGG - Intergenic
1087838225 11:102896017-102896039 ATGGGTCTCATGAGATCTGATGG + Intergenic
1087936289 11:104037394-104037416 AAGCCTCTCTTGCTCTCTCAAGG - Exonic
1088548053 11:110981553-110981575 AATGAAGTCTTGATCTCTGATGG + Intergenic
1091006017 11:131954404-131954426 CAGGGACTCTGGCTCTCTGAAGG + Intronic
1091268931 11:134292156-134292178 GAGCTTCTCTTGACCTCTGATGG + Exonic
1091362956 11:134992704-134992726 CAGCCTCTGTTGATCTCTGAAGG - Intergenic
1091433885 12:459236-459258 GAGGATCTCTTGATCTCTGGAGG - Intergenic
1091529926 12:1344410-1344432 AAGAAGCTGTTGATCTCTGAAGG + Intronic
1091711651 12:2745095-2745117 GTGGGACTCTTGATCTGTGAAGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093352974 12:18127154-18127176 ATGGGTCTCATGAGATCTGATGG + Intronic
1093564642 12:20588309-20588331 AAGGCCCTCTGGGTCTCTGAAGG - Intronic
1094182318 12:27604956-27604978 ATGGGTCTCATGAGATCTGATGG - Intronic
1095829086 12:46563984-46564006 AAGGGACTCTTAATCACTGTTGG - Intergenic
1095928674 12:47605014-47605036 ATGGGTCTCATGAGATCTGATGG - Intergenic
1096268861 12:50147512-50147534 AAGGGTCTCTGGATCCCCCAGGG - Intronic
1097169184 12:57103083-57103105 AAGGATCACTTGAGCCCTGAAGG - Intronic
1097400572 12:59123914-59123936 ATGGGTCTCATGAGATCTGATGG - Intergenic
1097654549 12:62343876-62343898 ATGGGTCTCATGAGATCTGATGG - Intronic
1098489422 12:71058331-71058353 ATGGGTCTCATGAGATCTGATGG + Intronic
1098792226 12:74837835-74837857 ATGGGTCTCATGAGATCTGACGG + Intergenic
1099990866 12:89719438-89719460 ATGGGTCTCATGAGATCTGATGG + Intergenic
1100739022 12:97570789-97570811 AAGGGTCCCTAGGTCTCTGTGGG + Intergenic
1101005679 12:100398842-100398864 ATGGGTCTCATGAGATCTGATGG + Intronic
1101117329 12:101544517-101544539 AAGAATCTCTTGAACTCAGAAGG + Intergenic
1101464727 12:104936606-104936628 ATGGGTCTCATGAGATCTGATGG - Intronic
1101566264 12:105908821-105908843 CAAGGTCACTTGATATCTGAGGG - Intergenic
1101956566 12:109217190-109217212 AAGGATCGCTTGAACCCTGAAGG + Intronic
1102588771 12:113941881-113941903 AGGGGTCTCATGATGTCTTAGGG + Intronic
1102596981 12:114000463-114000485 ATGGGTCTCATGAGATCTGATGG - Intergenic
1103211213 12:119167892-119167914 AAGGATCTCTTCCTCTCAGAAGG + Intergenic
1103567647 12:121824786-121824808 ATGGATCACTTGATCTCTGGAGG + Intronic
1104799160 12:131541714-131541736 ATGAGTCTCATGAGCTCTGATGG - Intergenic
1105319410 13:19303880-19303902 AAGGATCACTTGAGCTCAGAAGG + Intergenic
1105839333 13:24240168-24240190 AAGGATCACTTGAACCCTGAAGG + Intronic
1105907875 13:24832167-24832189 AAGGGTGACTTGATCTTTTATGG - Intronic
1107292891 13:38877177-38877199 AAGAGTCTCTGGTTGTCTGATGG + Exonic
1107364088 13:39651440-39651462 GAGGATCACTTGATCTCAGAAGG - Intergenic
1107520356 13:41174604-41174626 AAGGATCTCTTGATCCCAGGAGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107554620 13:41507155-41507177 ATGGGTCTCATGAGATCTGATGG - Intergenic
1109407444 13:61919930-61919952 ATGAGTCTCTTGAGATCTGATGG - Intergenic
1110377727 13:74813459-74813481 ATGGGTCTCATGAGATCTGATGG + Intergenic
1110377983 13:74815294-74815316 ATGGGTCTCATGAGATCTGATGG + Intergenic
1110559888 13:76899456-76899478 ATGGGTCTCATGAGATCTGATGG - Intergenic
1111088334 13:83406492-83406514 AAGGATCTCTTGAGCTCAGGAGG + Intergenic
1112052964 13:95662382-95662404 AAGGGTCTCAGGAGATCTGATGG + Intergenic
1112969378 13:105241115-105241137 GAATGTCTCTTGATGTCTGAAGG - Intergenic
1114215595 14:20655546-20655568 AAGTGGGTCTGGATCTCTGAGGG + Intergenic
1114587982 14:23832332-23832354 ATGGGTTTCTGGATCTCTGTAGG - Intergenic
1114842743 14:26284526-26284548 AAGGGTGTCTGAATCTCTGGGGG + Intergenic
1114904503 14:27109403-27109425 AAGAGTCTCATGAGATCTGATGG + Intergenic
1114984409 14:28209302-28209324 ATGGGTCTCATGAGATCTGATGG + Intergenic
1115113539 14:29853834-29853856 ATGGGTCTCATGAGATCTGATGG + Intronic
1115404299 14:32997549-32997571 ATGGGTCTCATGAGATCTGATGG + Intronic
1116154142 14:41182090-41182112 GAGGATCTCTTGAGCTCAGATGG + Intergenic
1117843635 14:59887786-59887808 AAGGTTTTCTTGATCTCTTTAGG - Intergenic
1118069742 14:62232714-62232736 ATGGGTCTCATGAGATCTGATGG + Intergenic
1118598151 14:67452007-67452029 ATGGGTCTCATGAGATCTGATGG + Intronic
1119203209 14:72774178-72774200 AAGAGTCGCTTGAACTCAGAAGG + Intronic
1120512282 14:85430188-85430210 ATGGGTCTCGTGAGGTCTGATGG - Intergenic
1120606245 14:86582301-86582323 ATGGGTCTCATGAGATCTGATGG + Intergenic
1121290370 14:92769628-92769650 AAGAATCGCTTGAACTCTGAAGG - Intergenic
1121991199 14:98559466-98559488 ATGGGTCTCATGAGATCTGATGG - Intergenic
1123910696 15:24963940-24963962 AAGGGTCACTTGATCCCAGGAGG + Intronic
1123914392 15:25007352-25007374 AAGGGTCTCTTGATCCCTGAAGG + Intergenic
1125254581 15:37748364-37748386 GAGGATCTCTTGAGCTTTGAAGG + Intergenic
1127121803 15:55778373-55778395 AAGGATCTCTTGAGCCCAGAAGG - Intergenic
1127123840 15:55793450-55793472 ATGGGTCTCATGAGATCTGATGG + Intergenic
1128861248 15:71075422-71075444 AAGGATCTCTTGAGCTCAGGAGG + Intergenic
1129516211 15:76159219-76159241 AAGGGTCAGGTGAGCTCTGATGG - Intronic
1129542823 15:76364808-76364830 TAGGGGCTCCTCATCTCTGAGGG + Intronic
1131227509 15:90637610-90637632 AAGGGTCTCTGGATATTAGAAGG - Intronic
1131642083 15:94303582-94303604 ATGGGTCTCATGAGATCTGATGG - Intronic
1131677634 15:94686903-94686925 GAGGTACTCTTGATCTCAGAAGG - Intergenic
1131809145 15:96154131-96154153 AAGTGTCTCCTGATGACTGATGG - Intergenic
1131914696 15:97251993-97252015 ACGGGTCTCATGAGATCTGATGG + Intergenic
1132640468 16:976014-976036 AGGGGCCTCATGAACTCTGAAGG + Intronic
1133331769 16:4979254-4979276 AACAGTGCCTTGATCTCTGAAGG - Intronic
1134476606 16:14579478-14579500 AAGGGTCACTTGAGCTCAGGAGG + Intronic
1135139010 16:19906090-19906112 AAGGATCTCTTGAGCCCGGAAGG - Intergenic
1138003820 16:53311094-53311116 AAGGATCACTTGATCTCAGGAGG + Intronic
1139867459 16:70074073-70074095 AAGGATCACTTGAACACTGAAGG - Intergenic
1149904202 17:60510311-60510333 AAGGATCACTTGAGCCCTGAAGG + Intronic
1150722870 17:67628427-67628449 AAGGAATTATTGATCTCTGATGG + Intronic
1151007831 17:70458647-70458669 ATGGGTCTCATGAAATCTGATGG - Intergenic
1151501131 17:74489803-74489825 ATGGGTCTCATGAGATCTGATGG - Intergenic
1151504573 17:74518743-74518765 ATGGGTCTCATGAGATCTGATGG + Intergenic
1152624141 17:81380507-81380529 CAGGGTCCCTTCATCTCAGAGGG - Intergenic
1153439439 18:5100578-5100600 CAGGGCCTGTTGATCTCTAAGGG + Intergenic
1153455139 18:5272314-5272336 ATGGGTCTCATGAGATCTGATGG - Intergenic
1154488877 18:14903638-14903660 CAGCCTCTGTTGATCTCTGAAGG + Intergenic
1156543314 18:37938680-37938702 ATGGGTCTCATGAGATCTGATGG + Intergenic
1159641344 18:70865692-70865714 ATGGGTCTCATGAGATCTGATGG + Intergenic
1159718993 18:71861651-71861673 ATGGGTCTCATGAGATCTGATGG - Intergenic
1159762923 18:72451227-72451249 ATGGGTCTCATGAGGTCTGATGG - Intergenic
1160252618 18:77216623-77216645 ATGGGTCTCATGAGATCTGATGG + Intergenic
1161143717 19:2664608-2664630 GAGGGTCTCTAGAGCACTGAGGG - Intronic
1161597416 19:5157754-5157776 ATGGGGCTATTGATCTGTGATGG - Intergenic
1162674874 19:12291606-12291628 AAGGATCTCTTGAGCCCTGGAGG + Intronic
1163507313 19:17715705-17715727 GAGGATCTCTTGAGCCCTGAAGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164624799 19:29719060-29719082 AAGAGTCTCTTGAACTCGGGAGG + Intergenic
1164872453 19:31657299-31657321 GAGGATCTCTTGAGCTCTGGAGG - Intergenic
1165082529 19:33317245-33317267 AAGAGTCTCTTGAACCCAGAAGG - Intergenic
1165929160 19:39344853-39344875 AAGGGTCTCTTGATCTCTGAAGG - Intronic
1166881054 19:45930390-45930412 AAGGATCGCTTGATCCCTGGAGG - Intergenic
1167355920 19:49004024-49004046 AAGGATCTCTTGATCCCTAGAGG + Intronic
1167358222 19:49016794-49016816 AAGGGTCTCTGGGTCTTTGTGGG - Intronic
1167359721 19:49023683-49023705 AAGGGTCTCTGGGTCTTTGTGGG - Intronic
1167361410 19:49032402-49032424 AAGGGTCTCTGGGTCTTTGTGGG + Intronic
1167362242 19:49036383-49036405 AAGGGTCTCTGGGTCTTTGTGGG - Intronic
1167363840 19:49044475-49044497 AAGGGTCTCTGGGTCTTTGTGGG + Intronic
1167364658 19:49048452-49048474 AAGGGTCTCTGGGTCTTTGTGGG - Intronic
1167365947 19:49055088-49055110 AAGGGTCTCTGGGTCTTTGTGGG - Intronic
1167421653 19:49407446-49407468 AAGGGCTTCTAGATCCCTGAGGG - Intronic
928826936 2:35434056-35434078 ATGGGTCTCATGAAATCTGATGG - Intergenic
929152738 2:38762013-38762035 AAGAGTCTCTTGAACTCGGGAGG - Intronic
930188897 2:48438076-48438098 AAGAATCGCTTGAACTCTGAAGG - Intergenic
930263253 2:49171104-49171126 ATGGGTCTCATGAGATCTGATGG + Intergenic
930272610 2:49274438-49274460 AAGTGTCTCTGGATGTCTGAGGG - Intergenic
930391140 2:50763051-50763073 AGGGCTCTCTTCATCTCTGAAGG + Intronic
931154564 2:59614078-59614100 ATGGGTCTCATGAGATCTGATGG - Intergenic
931413144 2:62054214-62054236 AAGGGACTCTTGAGCACTGTTGG + Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933787517 2:85855222-85855244 ATGGGTCTCATGAGATCTGATGG + Intronic
935094172 2:99927965-99927987 ATGGGTCTCATGAGATCTGATGG + Intronic
935965019 2:108464510-108464532 AAGGGTCCCTTGACCCCTGTGGG - Intronic
936948815 2:117956513-117956535 TATGGTGTCTTTATCTCTGAGGG - Intronic
937409024 2:121656643-121656665 AAGGGTCACTTGAGCCCTGGAGG + Intergenic
937806368 2:126150368-126150390 ATGAGTCTCATGAACTCTGATGG - Intergenic
937822720 2:126328998-126329020 AATGGTCACTTCATGTCTGAAGG - Intergenic
938017520 2:127879760-127879782 AGGTGTCTCTTGATCACTGTAGG - Intronic
938764255 2:134449906-134449928 AGGGGGCTCTTGATGTCTGCTGG + Exonic
939452020 2:142386359-142386381 ATGGGTCTCTCGAGATCTGATGG + Intergenic
940686454 2:156857099-156857121 ATGGGTCTCATGAGTTCTGATGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941123598 2:161560581-161560603 ATGGGTCTCATGAAATCTGATGG + Intronic
942323033 2:174752478-174752500 AAGGGTCACTTGAGCTCAGGAGG + Intronic
942657121 2:178225766-178225788 ATGGGTCTCATGACATCTGATGG - Intronic
943116873 2:183683663-183683685 ATGGGTCTCCTGAGATCTGATGG - Intergenic
944195268 2:197046537-197046559 AAGAGTTTCTTGCTCTCTGAGGG - Intronic
944808735 2:203307665-203307687 ATGGGTCTCATGAGATCTGATGG + Intergenic
944837041 2:203589996-203590018 GAGGATCTCTTGAACTCAGAAGG + Intergenic
945497995 2:210533212-210533234 AATGGTCTCTGGTTTTCTGAAGG + Intronic
945760196 2:213904415-213904437 ATAAGTCTCTTGATATCTGATGG - Intronic
945769360 2:214021467-214021489 ATGGGTCTCATGAGATCTGATGG - Intronic
946608290 2:221430437-221430459 CAGGGCCACATGATCTCTGAGGG - Intronic
947135137 2:226969904-226969926 AAGGGAATCTTGAACTCAGAAGG + Intronic
947296300 2:228634838-228634860 ATGGGTCTCATGAGATCTGATGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947825021 2:233099987-233100009 ATGGGTCTCATGAGATCTGATGG - Intronic
1168874007 20:1157790-1157812 AAGGGTCACTTCATTCCTGAAGG + Intronic
1169857850 20:10123362-10123384 ATGGGTCTCATGAGGTCTGATGG - Intergenic
1170665451 20:18382472-18382494 AAGGGCCTCTTGGTTTCAGAAGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171435886 20:25124305-25124327 CAGTGTCTGTTGGTCTCTGAAGG - Intergenic
1173389663 20:42620987-42621009 ATGGGTCTCATGAGATCTGATGG - Intronic
1173869757 20:46334017-46334039 AAAGGTCTCCTGATGTCTGCTGG + Intergenic
1174830373 20:53806731-53806753 GAGGGTCACTTGAGCTCAGAAGG + Intergenic
1176688908 21:9880989-9881011 ATGGGTCTCATGAAATCTGATGG - Intergenic
1178295402 21:31405675-31405697 ATGGGTCTCATGAGATCTGATGG - Intronic
1179245038 21:39625715-39625737 CAGGGACTCCTGATGTCTGAAGG + Intronic
1179429692 21:41312003-41312025 ATGGGTCTCATGAGATCTGATGG - Intronic
1179469258 21:41599593-41599615 ATGGGTCTCATGAGATCTGATGG + Intergenic
1181405260 22:22679902-22679924 CAGGGTCTTTTGAGCTCTGGAGG + Intergenic
1183864038 22:40690228-40690250 AAGGGGCACAGGATCTCTGACGG - Intergenic
1184328022 22:43806336-43806358 AAGGATCACTTGAGCCCTGAAGG - Intronic
1185153186 22:49178215-49178237 AAGGGGCTGTTGCTCTCCGAGGG - Intergenic
949247758 3:1945205-1945227 TATGTTCTCTTGATATCTGATGG + Intergenic
949301821 3:2592537-2592559 ATGGGTCTCATGAGATCTGATGG + Intronic
951317124 3:21201667-21201689 GTGAGTCTCTTGAGCTCTGACGG + Intergenic
952217931 3:31296112-31296134 AGAAGTCTCTTGATCTCTAAGGG - Intergenic
953137534 3:40195380-40195402 GAGGGTCTCTTGAGCACAGAAGG - Intronic
954516800 3:51185743-51185765 ATGGGTCTCATGAGATCTGATGG + Intronic
954517077 3:51187698-51187720 ATGGGTCTCTTGAGATCTGATGG + Intronic
956938455 3:74131019-74131041 ATGGGTCTCATGAGATCTGATGG - Intergenic
956938727 3:74132950-74132972 ATGGGTCTCATGAGATCTGATGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
958135362 3:89482689-89482711 AAAGGCCTCATGATCTCTGTTGG - Intergenic
958976843 3:100678583-100678605 AAGGCTTTCTAGATATCTGAAGG + Intronic
959054596 3:101554639-101554661 ATGGGTCTCATGAGATCTGATGG + Intergenic
959247840 3:103898054-103898076 AAGGATCCCTTGATCCCAGAAGG + Intergenic
959364189 3:105436063-105436085 ATGGGTCTCATGAGATCTGATGG - Intronic
960939746 3:122925869-122925891 GAGGGTCCCATGATCTGTGAGGG + Intronic
960949437 3:122989521-122989543 AAGGGCCTCTGGGGCTCTGAAGG + Intronic
962017909 3:131462015-131462037 AAGGATCACTTGAGCTCAGAAGG + Intergenic
962212556 3:133491317-133491339 GAGGGTATCTTCTTCTCTGAAGG - Intergenic
962249187 3:133824642-133824664 AAGGGTGTCCTGATCTGTGTGGG + Exonic
962500336 3:135984950-135984972 ATGGGTCTCATGAGATCTGATGG - Intronic
962634709 3:137319012-137319034 AAGTGTCTGTCGATCTCTGCTGG + Intergenic
962683621 3:137825075-137825097 AAGGGTCTCTTTAGCCCTCAGGG + Intergenic
963011521 3:140775022-140775044 ATGGGTCTCATGAGATCTGATGG - Intergenic
963011803 3:140776978-140777000 ATGGGTCTCATGAGATCTGATGG - Intergenic
963421178 3:145062496-145062518 ATGGGTCTCATGAGATCTGATGG - Intergenic
963642125 3:147873826-147873848 GAGGATCACTTGAGCTCTGAAGG - Intergenic
963952707 3:151220602-151220624 ATGGGTCTCATGAGATCTGATGG + Intronic
963952972 3:151222514-151222536 ATGGGTCTCATGAGATCTGATGG + Intronic
965822472 3:172698554-172698576 AAGGGTCTCTCAATCTCTCATGG + Intronic
965838953 3:172881421-172881443 ATGGGTCTCATGAGATCTGATGG + Intergenic
966059045 3:175733402-175733424 ATGGGTCTCATGAGATCTGATGG - Intronic
966060478 3:175749015-175749037 AAGGATCTCTTGAGCTCAGGAGG + Intronic
966270239 3:178096279-178096301 ATGGGTCTCATGAGATCTGATGG + Intergenic
967008499 3:185408480-185408502 AAGAATCACTTGAACTCTGATGG + Intronic
967505129 3:190245258-190245280 ATGGGTCTCATGAGATCTGATGG - Intergenic
967958989 3:194903600-194903622 ATGGGTCTCATGAGATCTGATGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970707868 4:18826687-18826709 ATGGGTCTCATGAGATCTGATGG - Intergenic
970740809 4:19235384-19235406 AAGAGTCGCTTGAACTCAGAAGG + Intergenic
971145323 4:23969947-23969969 AATGGTTTCTTCATCTCTGTGGG - Intergenic
971844987 4:31906886-31906908 ATGGGTCTCATGAGATCTGATGG - Intergenic
972190786 4:36588064-36588086 ATGGGTCTCATGAGATCTGATGG + Intergenic
972414206 4:38823047-38823069 ATGGGTCTCATGAAATCTGATGG - Intronic
972467378 4:39370269-39370291 ATGGGTCTCATGAGATCTGATGG + Intergenic
972729430 4:41778918-41778940 GAGGGTCTCTTGAGCTTTGGAGG + Intergenic
972935987 4:44136233-44136255 ATGGGTCTCATGAGATCTGATGG + Intergenic
974045340 4:56893770-56893792 AAGGATCTCTTGAGCACAGAAGG - Intergenic
974656890 4:64836858-64836880 AAGGGTCGCTTGAACTCGGGAGG - Intergenic
974977912 4:68915186-68915208 AATGTTCTCTTTATATCTGAAGG + Intergenic
976324027 4:83750554-83750576 GAGGGTCGCTTGATCCCAGAAGG + Intergenic
977728725 4:100326697-100326719 ATGGGTCTCATGAGATCTGATGG - Intergenic
978267526 4:106844166-106844188 ATGGGTCTCATGAGATCTGATGG - Intergenic
979352816 4:119665481-119665503 AAGGCTCTAGTGAACTCTGATGG + Intergenic
979389970 4:120117118-120117140 ATGGGTCTCATGAGATCTGATGG - Intergenic
979390257 4:120119057-120119079 ATGGGTCTCGTGAGATCTGATGG - Intergenic
979426051 4:120568680-120568702 AAAGGGCTGTTGATCTCTGGTGG - Intergenic
979426545 4:120573641-120573663 AGGGGTCTCATGATATCTGATGG - Intergenic
979496016 4:121383180-121383202 ATGGGTCTCATGAGATCTGATGG + Intergenic
980325378 4:131338169-131338191 ACGAGTCTCATGATATCTGATGG + Intergenic
980495106 4:133579195-133579217 ATGAGTCTCATGAGCTCTGATGG + Intergenic
982494296 4:156071127-156071149 ATGGGTCTCATGAGATCTGATGG - Intergenic
983668950 4:170214061-170214083 ATGGGTCTCATGAAATCTGATGG + Intergenic
983669216 4:170216136-170216158 ATGGGTCTCATGAGATCTGATGG + Intergenic
984104512 4:175528286-175528308 AAGGTTCTCCTGTCCTCTGAAGG - Intergenic
984438454 4:179734470-179734492 AACTGTCTCTTGATCAATGATGG + Intergenic
985101404 4:186462065-186462087 CAATGTCTGTTGATCTCTGAGGG - Intronic
985342044 4:188964916-188964938 ATGGGTCTCATGAGATCTGATGG + Intergenic
986756883 5:10845025-10845047 ATGGGTCTCATGAGATCTGATGG - Intergenic
986999941 5:13650384-13650406 AAGAGTCTCATGAGATCTGATGG + Intergenic
987071295 5:14339145-14339167 GAGGGTCACTTGAGCTCAGAAGG + Intronic
987289249 5:16492591-16492613 AAGGGTCTCATGCTCTCTACTGG + Intronic
987457689 5:18166709-18166731 AAAAGTCTCATGATATCTGATGG - Intergenic
987773415 5:22335320-22335342 ATGGGTCTCATGAGATCTGATGG + Intronic
988866809 5:35344107-35344129 ATGGGTCTCATGAGATCTGATGG - Intergenic
988888199 5:35582389-35582411 ATGGGTCTCATGAGATCTGATGG - Intergenic
990738716 5:58890908-58890930 AAGAGTATCGTGATGTCTGATGG - Intergenic
990853097 5:60229572-60229594 AATGGTCTCCTGAGTTCTGAAGG + Intronic
991616170 5:68498903-68498925 ATGGGTCTCATGAGATCTGATGG + Intergenic
993560981 5:89408177-89408199 GAGGGTCTCTGTCTCTCTGATGG - Intergenic
994542662 5:101120682-101120704 ATGGGTCTCATGAGATCTGATGG - Intergenic
994610535 5:102032312-102032334 ATGGGTCTCATGAGATCTGATGG + Intergenic
995085002 5:108098275-108098297 AAGGGTAGCTTGAACTCAGATGG + Intronic
996214447 5:120849891-120849913 ATGGGTCTCGTGAGATCTGACGG - Intergenic
996460035 5:123731589-123731611 ATGGGTCTCATGAGATCTGATGG + Intergenic
996600305 5:125254687-125254709 ATGGGTCTCATGAGATCTGATGG - Intergenic
998700312 5:144691156-144691178 AAGTGTCTCTTACTCACTGAGGG + Intergenic
999020967 5:148164772-148164794 ATGGGTCTCATGAGATCTGATGG + Intergenic
999694139 5:154173308-154173330 AAGAGTCTCTTCATTTATGAAGG - Intronic
1000229236 5:159299482-159299504 ATGAGTCTCTTGAGATCTGATGG - Intergenic
1003818310 6:9866299-9866321 ATGGGTCTCGTGAGATCTGATGG + Intronic
1004379747 6:15122528-15122550 ATGAGTCTCATGATATCTGACGG + Intergenic
1005513135 6:26530085-26530107 AAGGATCTCTTGAGCTCAGGAGG - Intergenic
1006513233 6:34532807-34532829 AAGAGTCTCCTGAGCCCTGAGGG + Exonic
1006696719 6:35937082-35937104 ATGGGTCTCATGAGATCTGATGG + Intergenic
1007628616 6:43260260-43260282 AATGGTCTGTTGACCTCGGATGG + Intronic
1008501743 6:52190424-52190446 GTTGGTCTGTTGATCTCTGAGGG - Exonic
1008858733 6:56123506-56123528 AATGGCCTCTTCAGCTCTGATGG + Intronic
1009825184 6:68857929-68857951 ATGGGTCTCATGAGATCTGATGG + Intronic
1009876535 6:69512510-69512532 ATGGGTCTCATGAGATCTGATGG + Intergenic
1010808537 6:80268385-80268407 GAGGTTCTCTTGATTTCAGAAGG + Intronic
1011152702 6:84291454-84291476 ATGGGTCTCATGAGATCTGATGG - Intergenic
1011474636 6:87739436-87739458 AAGAATCACTTGAACTCTGAAGG - Intergenic
1011920519 6:92570462-92570484 ATGGGTCTCATGAGATCTGATGG - Intergenic
1012678828 6:102153342-102153364 GAGTGTCTCTTGAGCACTGAGGG + Intergenic
1013369641 6:109457542-109457564 TATGGTCTCTGGATCTCTTATGG - Intergenic
1013693568 6:112673889-112673911 AGGGGTCTCATGAGATCTGATGG - Intergenic
1013981712 6:116137649-116137671 AAGTGTCTGTTGATGGCTGAAGG - Intronic
1013998563 6:116338860-116338882 AAGAATCTCTGGACCTCTGAGGG + Intronic
1014166787 6:118233911-118233933 AAGGGTCTCTTGACCTTTGGTGG - Intronic
1014388570 6:120832119-120832141 AAGGGTCTCTTGAGCTCAGGAGG + Intergenic
1015217023 6:130762067-130762089 ATGGGTCTCATGAGATCTGATGG - Intergenic
1015490817 6:133823639-133823661 ATGGGTCTCATGAGATCTGATGG - Intergenic
1016139604 6:140592997-140593019 ATGGGTCTCATGAGATCTGATGG + Intergenic
1016201501 6:141415879-141415901 AAGGATCACTTGAGCTCTGGAGG - Intergenic
1016358789 6:143246424-143246446 ATGGGTCTCATGAGATCTGATGG - Intronic
1016537496 6:145125299-145125321 ATGGGTCTCATGAGATCTGATGG + Intergenic
1016649731 6:146449575-146449597 ATGGGTCTCATGAAATCTGATGG - Intergenic
1017105511 6:150884079-150884101 GAGGATCTCTTGATCTCAGGAGG + Intronic
1017618083 6:156266251-156266273 ATGGGTCTCATGAGATCTGATGG - Intergenic
1018473024 6:164113101-164113123 ATGGGTCTCATGAGATCTGATGG + Intergenic
1018536821 6:164829048-164829070 AAGGGTCTCTGGGACTCTCAAGG - Intergenic
1019637128 7:2081866-2081888 AGGGGTCCCGTGATCTCTGTTGG - Intronic
1019911658 7:4104147-4104169 GAGGATCGCTTGAGCTCTGAGGG - Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020782576 7:12535384-12535406 ATGGGTCTCATGAGATCTGATGG - Intergenic
1021177208 7:17462855-17462877 AAGGGACTCATGAAATCTGAGGG + Intergenic
1021315163 7:19139968-19139990 AAGGTGCTTTTGATCTTTGAAGG + Intergenic
1021456774 7:20838040-20838062 GCGGGTCTCAAGATCTCTGATGG + Intergenic
1022458059 7:30576685-30576707 ATGGGTCTCATGAGATCTGATGG - Intergenic
1023301972 7:38782782-38782804 TTGGGTCTCATAATCTCTGAGGG + Intronic
1023619580 7:42055986-42056008 ATGGGTCTCATGAGATCTGATGG + Intronic
1024072824 7:45800848-45800870 GAGGATCGCTTGATCTCAGAAGG - Intergenic
1024158156 7:46647467-46647489 AAAAGTCTCATGATATCTGATGG - Intergenic
1024650515 7:51399329-51399351 GAGGATCACTTGATCTCAGAAGG + Intergenic
1024894493 7:54242130-54242152 ATGGGTCTCTCGAGTTCTGATGG + Intergenic
1025054648 7:55754994-55755016 GAGGATCGCTTGATCTCAGAAGG + Intergenic
1025132706 7:56385141-56385163 GAGGATCACTTGATCTCAGAAGG + Intergenic
1025245050 7:57310616-57310638 AAGGATCTCTTGAGCCCTGGAGG - Intergenic
1027338281 7:77177798-77177820 AAGGGTGCCTGGATGTCTGAAGG - Intronic
1027528964 7:79306094-79306116 AAGGATCTCTTGAGCCCAGAAGG - Intronic
1028250216 7:88531340-88531362 ATGGGTCTCATGAGATCTGATGG + Intergenic
1028549912 7:92049011-92049033 AAGGCTCTCTGAATCTCTAATGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029104849 7:98166612-98166634 AAGGGTCTCTTGAGCCCAGGAGG + Intronic
1029544424 7:101202729-101202751 GAGGGTCACTTGAGCCCTGAAGG - Intergenic
1029777445 7:102693004-102693026 AAGGGTGCCTAGATGTCTGAAGG + Intergenic
1030236619 7:107270348-107270370 AAGGATCACTTGATCCCAGAAGG - Intronic
1030353656 7:108519716-108519738 TAGCATCTGTTGATCTCTGATGG - Intronic
1030621542 7:111796033-111796055 AAGGTCCTCATGATCTCTGCTGG + Intronic
1030783009 7:113624966-113624988 ATGGGTCTCATGAGATCTGATGG - Intergenic
1032050202 7:128644531-128644553 GAGGATCGCTTGATCTCAGAAGG - Intergenic
1032835965 7:135673846-135673868 AAGGATCACTTGAGCTCTGGAGG + Intronic
1033726336 7:144122680-144122702 AATGATCTCTTGGTCTCTGCTGG - Intergenic
1033805252 7:144946843-144946865 ATGGGTCTCATGAAATCTGATGG - Intergenic
1036059411 8:5298844-5298866 AAAGGTCTCATGATTTCAGAGGG + Intergenic
1036123289 8:6040888-6040910 ATGGGTCTCATGAGATCTGATGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037051688 8:14381694-14381716 AAGGGTCTCTTGAGCCCAGGAGG + Intronic
1037200853 8:16250519-16250541 ATGGGTCTCATGAGATCTGATGG - Intronic
1038746743 8:30261435-30261457 ATGGGTCTCATGAGATCTGATGG + Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1038814289 8:30885336-30885358 ATGGGTCTCATGAGATCTGATGG + Intronic
1039076549 8:33695180-33695202 ATGGGTCTCATGAGATCTGATGG + Intergenic
1039081986 8:33742669-33742691 AAGGATCCCTTGAGCTCAGAAGG - Intergenic
1039649163 8:39322043-39322065 ATGGGTCTCATGAGATCTGATGG - Intergenic
1039933434 8:42016877-42016899 AAATGACTCTGGATCTCTGAGGG + Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041374193 8:57195663-57195685 AAGGTTCTCTTCACTTCTGAAGG - Intergenic
1041707921 8:60865776-60865798 AAGGGTCTCTCCATCTTTAAAGG - Exonic
1043345284 8:79291066-79291088 TAAGGTTTCTTCATCTCTGAAGG + Intergenic
1043518705 8:81020470-81020492 ATGGGTCTCGTGAGATCTGATGG + Intronic
1043555203 8:81422149-81422171 AAGGCTGTGTGGATCTCTGATGG + Intergenic
1043993268 8:86781539-86781561 ATGAGTCTCATGAGCTCTGATGG + Intergenic
1044016005 8:87049529-87049551 ATGGGTTTCTTGTTCTGTGAAGG + Intronic
1046259271 8:111745270-111745292 GAAGGTCTCTTGCTCTCTGCGGG - Intergenic
1047149286 8:122242170-122242192 ATGGGTCTCATGAGATCTGATGG + Intergenic
1047876169 8:129140013-129140035 ATGGGTCTCATGAAATCTGATGG + Intergenic
1048027669 8:130601543-130601565 ATGGGTCTCATGACATCTGATGG + Intergenic
1048032452 8:130645464-130645486 ATGGATCTCTTAATATCTGACGG + Intergenic
1049161310 8:141099693-141099715 AAGGCTGTGTTGATCACTGATGG - Intergenic
1049863003 8:144913211-144913233 ATGGGTCTCATGAGATCTGATGG + Intergenic
1051957328 9:22712184-22712206 ATGGGTCTCATGAGGTCTGATGG + Intergenic
1052006856 9:23359930-23359952 ATGGGTCTCCTGAGATCTGATGG - Intergenic
1053062244 9:35041514-35041536 AAGGCTCTCTTGAGCTCAGGAGG + Intronic
1053432279 9:38050573-38050595 AAGGGACTTTAGATCTGTGAAGG - Intronic
1053780419 9:41600911-41600933 ATGGGTCTCATGAAATCTGATGG + Intergenic
1054168361 9:61811068-61811090 ATGGGTCTCATGAAATCTGATGG + Intergenic
1054669168 9:67769750-67769772 ATGGGTCTCATGAAATCTGATGG - Intergenic
1055083305 9:72289536-72289558 ATGGGTCTCATGAGATCTGATGG - Intergenic
1055772397 9:79731254-79731276 AAGGGGCTATGAATCTCTGACGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1056994772 9:91445604-91445626 CAGGGGCTCTAGTTCTCTGAGGG + Intergenic
1057003092 9:91530895-91530917 AAGGGTCTCTTGAAATCTCTGGG + Intergenic
1057393789 9:94661366-94661388 AAAGGTCTGTTGACCTCTAAGGG + Intergenic
1057915579 9:99052868-99052890 AAGGGTCTCCTGAGCTCCCACGG - Intronic
1058662756 9:107281872-107281894 AAGGATCTCTTGAGCTCAGGAGG + Intergenic
1059457674 9:114409938-114409960 AAGGGCCTCTTCATCTCAGTTGG + Intronic
1059582700 9:115568399-115568421 ATGGGTCTCATGATATCTGATGG + Intergenic
1060738872 9:126084375-126084397 AAGGGTTTCGTGATCCATGAAGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186004652 X:5056110-5056132 GAGGGTCACTTGGGCTCTGAAGG - Intergenic
1186148083 X:6645716-6645738 AAGAGTCTCATGAGATCTGATGG + Intergenic
1186714946 X:12241809-12241831 AAGGATCTCTTGAGCCCAGAAGG + Intronic
1188029766 X:25251348-25251370 ATGGGTCTCATGAGATCTGATGG + Intergenic
1188297898 X:28472306-28472328 ATGGGTCTCATGAGATCTGATGG - Intergenic
1189563633 X:42216643-42216665 AAGAGTCTTTGGAGCTCTGAAGG - Intergenic
1189772273 X:44438319-44438341 ATGGGTCTCATGAGATCTGATGG + Intergenic
1190540018 X:51467840-51467862 AAGGATCACTTGAGCTCTGTAGG - Intergenic
1190865158 X:54378297-54378319 GAGGATCTCTTGAACTCTGGAGG - Intergenic
1191596041 X:62945127-62945149 ATGGGTCTCATGAGATCTGATGG - Intergenic
1191736513 X:64394160-64394182 ATGGGTCTCATGAGATCTGATGG - Intronic
1192346877 X:70317467-70317489 AAGGGGATCATGATCTCGGAGGG - Intronic
1192620493 X:72674613-72674635 AAGTGTCTGTTCATATCTGAAGG + Intronic
1193188420 X:78540188-78540210 ATGGGTCTCATGAGGTCTGATGG - Intergenic
1193565788 X:83075441-83075463 AATGGTGTCTTGATATTTGATGG + Intergenic
1194269616 X:91794905-91794927 ATGGGTCTCATGATATCTGATGG + Intronic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1196125331 X:112092730-112092752 ATGGGTCTCATGAGATCTGATGG + Intergenic
1197103815 X:122689165-122689187 ATGGGTCTCATGAGATCTGATGG + Intergenic
1197301841 X:124790118-124790140 ATGGGTCTCATGAGATCTGATGG - Intronic
1197610775 X:128635789-128635811 ATGGGTCTCATGAGATCTGATGG - Intergenic
1198614300 X:138438580-138438602 ATGGGTCTCATGAGATCTGATGG - Intergenic
1199229396 X:145418521-145418543 AACAGTCTCATGAGCTCTGATGG + Intergenic
1200345154 X:155440417-155440439 TAAGTTCTCTTGATATCTGATGG - Intergenic
1200586838 Y:5015886-5015908 ATGGGTATCATGATATCTGATGG + Intronic
1200601245 Y:5208183-5208205 ATGGGTCTCCTGAGATCTGATGG - Intronic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1201621624 Y:15965446-15965468 AAGGAACTCTTGTTCTCTGTTGG + Intergenic
1201924198 Y:19267090-19267112 ATGGGTCTCATGAGATCTGATGG - Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic