ID: 1165931093

View in Genome Browser
Species Human (GRCh38)
Location 19:39359238-39359260
Sequence GCAGGCAGTTGGATTACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2149
Summary {0: 1, 1: 0, 2: 1, 3: 75, 4: 2072}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165931084_1165931093 25 Left 1165931084 19:39359190-39359212 CCAGTGTCTTACACAGCTTCGTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1165931093 19:39359238-39359260 GCAGGCAGTTGGATTACCTCTGG 0: 1
1: 0
2: 1
3: 75
4: 2072
1165931088_1165931093 -6 Left 1165931088 19:39359221-39359243 CCACTGTCCCATCCTGAGCAGGC 0: 1
1: 0
2: 5
3: 26
4: 251
Right 1165931093 19:39359238-39359260 GCAGGCAGTTGGATTACCTCTGG 0: 1
1: 0
2: 1
3: 75
4: 2072
1165931085_1165931093 -4 Left 1165931085 19:39359219-39359241 CCCCACTGTCCCATCCTGAGCAG 0: 1
1: 1
2: 4
3: 34
4: 267
Right 1165931093 19:39359238-39359260 GCAGGCAGTTGGATTACCTCTGG 0: 1
1: 0
2: 1
3: 75
4: 2072
1165931086_1165931093 -5 Left 1165931086 19:39359220-39359242 CCCACTGTCCCATCCTGAGCAGG 0: 1
1: 0
2: 2
3: 23
4: 202
Right 1165931093 19:39359238-39359260 GCAGGCAGTTGGATTACCTCTGG 0: 1
1: 0
2: 1
3: 75
4: 2072

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165931093 Original CRISPR GCAGGCAGTTGGATTACCTC TGG Intronic
Too many off-targets to display for this crispr