ID: 1165931639

View in Genome Browser
Species Human (GRCh38)
Location 19:39362924-39362946
Sequence AAGCAGAGCCTGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165931639 Original CRISPR AAGCAGAGCCTGAAAGTGGA GGG (reversed) Intronic
900290216 1:1920576-1920598 AGGCAGAGCCCAACAGTGGAAGG - Intergenic
901935125 1:12621460-12621482 AAGCAGAGCCTGATTCAGGAGGG - Intergenic
902082579 1:13831259-13831281 AGGCTGAGGCTGAGAGTGGAGGG + Intergenic
902179718 1:14678667-14678689 AACCTGAGCCTGAGAGGGGAAGG - Intronic
902196445 1:14802031-14802053 AAGCAGGGCATGACAGAGGAAGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
905210995 1:36374099-36374121 AGGCAGGGCCTGAAAGTCCAGGG + Intronic
907092156 1:51735128-51735150 AAGCAGTGACAGAAAATGGAAGG + Intronic
907451593 1:54548947-54548969 CAGCAGCGCCTGGCAGTGGATGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
911600899 1:99847369-99847391 TAGGAGAGACTGAAAGTGGGAGG + Intergenic
913218400 1:116639552-116639574 AAGAAGAGCATGAAAGGAGAAGG - Intronic
915204055 1:154256217-154256239 AAGCTGAGCCTGTAAAGGGAAGG + Intronic
916627603 1:166575210-166575232 AAGTGGGGCATGAAAGTGGATGG + Intergenic
917226730 1:172791297-172791319 AGGCTCAGCCTGAATGTGGAAGG + Intergenic
917609849 1:176677277-176677299 CAGCAGACCCTGAAAATGTAGGG - Intronic
917650796 1:177075535-177075557 AAGCTGAACCTGAATTTGGAGGG + Intronic
917670556 1:177269717-177269739 AAGAGCAGCCTGAAAGTGGACGG + Intronic
918406085 1:184213177-184213199 AAGATGGGCCTGAAAGTGAAAGG - Intergenic
918617098 1:186557494-186557516 AAGAAGAGACAGAGAGTGGAGGG - Intergenic
918766807 1:188497582-188497604 ATGCAGAGGCTGAAAGTAAAGGG - Intergenic
918815129 1:189171629-189171651 AGGCAGCATCTGAAAGTGGATGG + Intergenic
918857937 1:189782614-189782636 AAGGAGAGCCTGAAGGCAGACGG - Intergenic
919240847 1:194914361-194914383 AAGGAGAGCTGGAAAGGGGAAGG - Intergenic
921625297 1:217372790-217372812 CAGCTGTGCCTGAAAGTGCAGGG - Intergenic
921674577 1:217963889-217963911 AAACAGCTCCTAAAAGTGGAAGG + Intergenic
921749853 1:218779764-218779786 AAGCAGAGCCTGAGAGCAGCAGG - Intergenic
922233817 1:223708220-223708242 AAGCAAAGCCTGGTGGTGGACGG + Intronic
922304483 1:224332090-224332112 GAGCAGAGACTGAAACTGGTAGG - Intergenic
922319113 1:224469849-224469871 AAGGAAGGCCTGAAAGTAGAAGG - Intronic
923779362 1:237008509-237008531 GAGCAGAGCCTTAACGTGGAAGG - Intergenic
923834746 1:237597955-237597977 AGACATAGCCTGAAAGTGAAGGG + Intronic
924494818 1:244576741-244576763 AAGCTGAGCCTAGAAATGGAAGG - Intronic
1065555257 10:26908730-26908752 AAGCAGAGCCTGGAGATGGGCGG - Intergenic
1065595595 10:27308076-27308098 AAGCAGAGCCTGGAGATGGGCGG + Intergenic
1066143579 10:32532834-32532856 ACACACAGCCTGAAAGTGAATGG - Intronic
1066577491 10:36842581-36842603 AAGCAGAGCCTGGAGATGGAAGG + Intergenic
1067132991 10:43582881-43582903 ACGCATAGACTGAAAGTGAAGGG - Intergenic
1068216331 10:53987397-53987419 ATGCAGAGCTTAAGAGTGGATGG + Intronic
1068356633 10:55918348-55918370 ATGCACAGACTGAAAGTGAAGGG + Intergenic
1068559619 10:58498954-58498976 AAGCTGTGCCTGCAGGTGGATGG - Intergenic
1068648403 10:59494800-59494822 ACACATAGCCTGAAAGTGAAGGG - Intergenic
1069059541 10:63881088-63881110 ACACAGAGGCTGAAAGTGAAGGG - Intergenic
1069125624 10:64628933-64628955 AAGGAGAGCTGAAAAGTGGATGG - Intergenic
1069237816 10:66100060-66100082 AAGCAGAGTCTGAGATTGGAAGG + Intronic
1070091231 10:73287642-73287664 AAGCAAAGTATGAAAGAGGAAGG + Intronic
1070627452 10:78061486-78061508 AAGCAAACCCTGATAGAGGAGGG - Intergenic
1071723842 10:88176071-88176093 AGACAGAGCCTGAAAGTGAAGGG - Intergenic
1072741814 10:97914347-97914369 TGGCAGAGCCTCAGAGTGGAAGG + Intronic
1074394495 10:113086385-113086407 AAGCAGAGCCCAGAACTGGAAGG - Intronic
1074446499 10:113525290-113525312 AAGAAGACCCTGAGAGTGGGAGG + Intergenic
1074522801 10:114240116-114240138 AAGCAGAACCTGAGAGGGGCCGG + Intronic
1075084545 10:119405687-119405709 ATGCAGAGCTGGAAAGTGGCAGG - Intronic
1075627771 10:123974930-123974952 AAGCAGAAGGTGACAGTGGAAGG + Intergenic
1076578503 10:131490425-131490447 CTGCAGAGCCAGAAAGTAGATGG + Intergenic
1076661066 10:132056496-132056518 CAGCAGAGCCACAAAGGGGATGG - Intergenic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1079683712 11:23330263-23330285 AAGCTAAACCTGGAAGTGGAAGG - Intergenic
1079803879 11:24904889-24904911 ATGCATAGACTGAAAGTGAAGGG + Intronic
1080334239 11:31177650-31177672 AAATATAGACTGAAAGTGGAGGG + Intronic
1083094427 11:60234936-60234958 AAACACAGGCTGAAAGTGAAGGG + Intronic
1084454020 11:69257104-69257126 AGGCAGAGCCTGGTAATGGAAGG + Intergenic
1084534147 11:69746922-69746944 AAGCAGAGAGGGAAGGTGGAGGG - Intergenic
1084700982 11:70785904-70785926 AAGCAGGGGCTCAAAGAGGAGGG + Intronic
1085042978 11:73337744-73337766 TGGCAGAGACTGAAAGTGAAGGG - Intronic
1085312526 11:75525102-75525124 AAGCAGAGGCTGGAACTGGCTGG - Intronic
1085926813 11:81033540-81033562 AAGAAGAGCCTAAAAAGGGAAGG + Intergenic
1086325980 11:85699882-85699904 AATGAGACCCTGAGAGTGGAGGG + Intronic
1086409711 11:86532000-86532022 AACCAGAAACTGAAAGTGGAGGG + Intronic
1086582919 11:88420264-88420286 AAGAAGAGTCTCAAAGGGGATGG + Intergenic
1087028626 11:93679705-93679727 AATCAGAACTTGAAATTGGAGGG - Intronic
1087162313 11:94960722-94960744 AAGCAAAGCAATAAAGTGGATGG + Intergenic
1087270403 11:96105488-96105510 AAGATGAGCCTGAAATTGCAGGG - Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1088172187 11:107010818-107010840 GAGAATAGCCTGAAAGTGGGAGG - Intronic
1088398282 11:109392959-109392981 AAGGACAGTCTGAAAGTGAAAGG + Intergenic
1089054382 11:115573488-115573510 AAGCAAAGACTGAAAGGGAAAGG - Intergenic
1089113132 11:116072623-116072645 AGGCAGAGCCTGCAAAAGGATGG + Intergenic
1090245908 11:125215807-125215829 AAGCAGAGGCTGGAAGTGAAAGG + Intronic
1090612433 11:128483531-128483553 AAAAAGAGCCAGAAAGGGGAAGG + Intronic
1090851088 11:130571136-130571158 AAGCAGAGCCTAAGAGTTTAAGG - Intergenic
1091083910 11:132701509-132701531 AAACATAGGCTGAAAGTGAAAGG - Intronic
1092140258 12:6178892-6178914 AGGCAGAGCCTGGAACTGGATGG - Intergenic
1092449006 12:8584765-8584787 TAGCAGACCGGGAAAGTGGAGGG + Intergenic
1093781198 12:23139544-23139566 AATGAGAGCATGAAAGTGCAGGG - Intergenic
1094768098 12:33620773-33620795 TGCCAGAGCCAGAAAGTGGAAGG + Intergenic
1095644408 12:44526293-44526315 AAGCAGAGTCTCATAGTGGTTGG + Intronic
1095999808 12:48119596-48119618 CAGCTGAGCCTGCAAGCGGAGGG - Intronic
1096157214 12:49347356-49347378 AAGCAGAGCCCCTAACTGGAAGG + Exonic
1096172104 12:49479651-49479673 CAGTGGAGCCTGAAAGTGGGTGG - Intronic
1096814123 12:54191023-54191045 AAGCAGACTTTGAATGTGGAGGG - Intergenic
1096817104 12:54208649-54208671 CAGCAGAGCTGGAATGTGGAGGG - Intergenic
1098741346 12:74177493-74177515 GAGCAAAGACTTAAAGTGGATGG + Intergenic
1099432701 12:82606699-82606721 AAGCCATGCCTGAAACTGGATGG + Intergenic
1101638812 12:106570354-106570376 AAGCAGAGCTTGAATGTGGGAGG + Intronic
1102528562 12:113529470-113529492 AAGCAAAGGCTTAAAGAGGATGG + Intergenic
1103313807 12:120034868-120034890 AAACAGAGACTGGAAGTGGCAGG - Intronic
1104265862 12:127231966-127231988 AAGGAGAGCTGGAAAGGGGATGG - Intergenic
1104390732 12:128388767-128388789 AATCAGCGCCCGGAAGTGGAGGG - Intronic
1105605562 13:21923810-21923832 AAGCAGAGCTCAAAAGAGGATGG - Intergenic
1106316036 13:28594640-28594662 ATGGAGACCCTGAAAGTGAAAGG + Intergenic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1107065568 13:36211326-36211348 AAGCAGAGACATAAAGTGGCAGG - Intronic
1107266485 13:38561762-38561784 AAGCAGAGTGTGAAAGTCAAGGG - Intergenic
1107339048 13:39386713-39386735 ACACAGAGCCTGCAAGTGGCTGG + Intronic
1107356486 13:39572708-39572730 CAGCTGAGTCTTAAAGTGGAAGG - Intronic
1108052616 13:46461135-46461157 AAGAAGATACTGAAATTGGACGG - Intergenic
1108071592 13:46634501-46634523 AGGCACAGCCTGAATGAGGAAGG - Intronic
1108952391 13:56111537-56111559 TAGCAGAGGCTGAAAGAGGTAGG - Intergenic
1108967155 13:56322847-56322869 AATTAGAGCTTGAAAGTGGAGGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110476891 13:75926653-75926675 AAGCCAACTCTGAAAGTGGAAGG + Intergenic
1110947522 13:81441905-81441927 GAGTAGAGACTGAAAGAGGAGGG + Intergenic
1111625916 13:90786511-90786533 ACACAGAGACTGAAAGTGAAGGG - Intergenic
1111739715 13:92188788-92188810 ATGCTGAACCAGAAAGTGGAAGG - Intronic
1112339526 13:98541507-98541529 CATCAGAGCCAGAAAGTGGGAGG + Intronic
1113616345 13:111683373-111683395 AAGCAGAACCTTCCAGTGGATGG - Intergenic
1113621813 13:111768266-111768288 AAGCAGAACCTTCCAGTGGATGG - Intergenic
1114387900 14:22274039-22274061 AAGCACAGCCTGAAATTATAGGG + Intergenic
1114822123 14:26033360-26033382 AGGCAAAGTGTGAAAGTGGAAGG - Intergenic
1116932688 14:50705440-50705462 AAGCAGTGACTGAAAGCAGAAGG - Intergenic
1119137581 14:72234675-72234697 AAGCAGAGACTGAGAGCGGCTGG - Intronic
1119543514 14:75455929-75455951 CAGCAGAGCCTGGATGCGGAAGG - Intronic
1119849789 14:77858992-77859014 AAGCAGAGCAGGAAGGTGAAGGG + Intronic
1120874591 14:89363755-89363777 AAGCAGAGGCTGTAAGTTCATGG - Intronic
1124199557 15:27666711-27666733 AGGCTGAGGCTGAAACTGGATGG - Intergenic
1125017332 15:34949294-34949316 AAGAAGAGCCTTAAAGTTAAAGG - Intronic
1127848671 15:62894343-62894365 AATCAAAGCCTGAAATTGGCAGG + Intergenic
1129490876 15:75924437-75924459 AAGCAGAGCCTCTAGGTTGAAGG + Intronic
1130230467 15:82092983-82093005 AAGCTGAGACTGAGACTGGAGGG + Intergenic
1130769891 15:86913782-86913804 CACCTGAGCCTGGAAGTGGAAGG + Intronic
1132399133 15:101494597-101494619 ACGCAGAGCCTGAAGCTGCAGGG - Intronic
1135347709 16:21703288-21703310 AAGCAGAGCCTTAGAATGGTTGG - Intronic
1137806174 16:51307601-51307623 AATCAGAGACTGAAAGATGAAGG - Intergenic
1138190779 16:55012060-55012082 AGGCAGAGCGTAACAGTGGATGG - Intergenic
1138300418 16:55922319-55922341 ACACAGAGACTGAAAGTGAAAGG + Intronic
1139239093 16:65372079-65372101 AAGAAGAGGCTGAAAGTCAAGGG + Intergenic
1139439360 16:66957765-66957787 AAGCAGAGGCTAAAAGTCCAAGG - Intergenic
1139539798 16:67606281-67606303 AGGCAGAGTTTGACAGTGGAGGG - Intronic
1140487092 16:75302081-75302103 AAGCAGAGCATAAAGGAGGATGG + Intronic
1140766654 16:78165611-78165633 GAGCAGAGCCTGAAGGGGGCTGG + Intronic
1141520000 16:84572203-84572225 GAGCAATGCCTGAAACTGGAGGG + Intronic
1141685616 16:85568206-85568228 AAGCAGACCCTGGAAGAAGATGG - Intergenic
1141866688 16:86754897-86754919 AAGCTGAGCATGAAAGGAGAGGG - Intergenic
1142325691 16:89413052-89413074 AACCAGAGCCTGGAGGGGGAGGG + Intronic
1143082086 17:4389250-4389272 ATGCAGAGCCTGATAGAGTAAGG + Intergenic
1143327344 17:6108067-6108089 AAGAACAGCCTGACAGTGGGGGG + Intronic
1143530956 17:7503107-7503129 AAGCGGAACCTGGAAGTGCAAGG - Exonic
1143776778 17:9204760-9204782 ATGCAGAGCTTGGAAGTTGAAGG + Intronic
1144205479 17:12976835-12976857 AAGCAGAGTCTGAGAGTGGTGGG + Intronic
1145237962 17:21222368-21222390 AAACAGAGCAGGAATGTGGAAGG + Intergenic
1145911500 17:28546086-28546108 AAGGAGGGCCTGAAACTGTAGGG + Intronic
1146684210 17:34829698-34829720 AGGCAAAGCCTGATAGTGGATGG - Intergenic
1147896012 17:43751851-43751873 AAGCAAAGACTGCAAGTGCATGG - Intergenic
1148214866 17:45829031-45829053 AAGCAGAGCCTCAAACTGGACGG + Intronic
1148470751 17:47891694-47891716 AAGCTGGGCCTGAAAGAGAAGGG + Intergenic
1150535677 17:66037327-66037349 AAGGAGAGCTGGAGAGTGGATGG - Intronic
1152466769 17:80471045-80471067 AAACAGAGGATGAGAGTGGAGGG + Intronic
1153707715 18:7763266-7763288 AAGCAAAGCCTGGAGATGGAAGG + Intronic
1155465761 18:26133722-26133744 AAGCAGTGCCTGTGAGTTGACGG - Intergenic
1156400644 18:36736508-36736530 AAGGAGAGCTGGAAAGGGGATGG + Intronic
1156661620 18:39352778-39352800 AGGCAGAGCATGGAAGAGGAAGG - Intergenic
1156762671 18:40612448-40612470 AAGGAATGCCTTAAAGTGGATGG - Intergenic
1157297246 18:46455273-46455295 CTGCTGGGCCTGAAAGTGGAGGG + Intronic
1157813965 18:50717684-50717706 AACCTGAGCCTGCAAGTGGCAGG + Intronic
1159970384 18:74644933-74644955 AAGCAGAAAATAAAAGTGGATGG - Intronic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160481520 18:79245074-79245096 GAGCAGATCCTGACAGTGGGGGG - Intronic
1161527318 19:4764574-4764596 GAGCAGAGCCTGAATGAGCAAGG + Intergenic
1163018188 19:14469605-14469627 AAGCAAGGCCTGAGGGTGGAGGG - Intronic
1163237954 19:16040203-16040225 AAGCAGAGACAGCAAGTGGCGGG - Intergenic
1163545942 19:17941675-17941697 CAGCACAGCAGGAAAGTGGAGGG - Intronic
1164458311 19:28427084-28427106 CACCAGAGCCTGAAAGGGGATGG + Intergenic
1164535222 19:29081003-29081025 ATGGAGAGCCTGAGACTGGAAGG + Intergenic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1165123318 19:33577470-33577492 AACCTGAGCCTGAGAGTGGAGGG + Intergenic
1165161540 19:33819815-33819837 AAGCAGAGCCTGGGAGGGGCAGG + Intergenic
1165931639 19:39362924-39362946 AAGCAGAGCCTGAAAGTGGAGGG - Intronic
1165939582 19:39408390-39408412 AGGCAGAGGGTGACAGTGGAAGG - Exonic
1166369806 19:42294415-42294437 AAGCACAGCCTGTCAGTGGTGGG + Intronic
1166528836 19:43530272-43530294 CAGCAGGGCCTGGAAGTGGGTGG - Intronic
1166911392 19:46160745-46160767 AAGCAGGGCCAGAAGGTGCAGGG - Exonic
1167353644 19:48991127-48991149 ATGCAGGGCCTGGAAGTGGGTGG - Intronic
1167696331 19:51017460-51017482 AAGAAGCGCGTGAAAGTGGAAGG + Intronic
1168135576 19:54349173-54349195 AAACAGATCCTGAGGGTGGATGG + Intergenic
1168135636 19:54349421-54349443 ACGCAGATCCTGAGGGTGGATGG + Intergenic
1168135650 19:54349481-54349503 ATGCAGATCCTGAGGGTGGACGG + Intergenic
1168135680 19:54349605-54349627 ACGCAGATCCTGAGGGTGGATGG + Intergenic
1168289095 19:55348289-55348311 AAGCACAGCCTGAGTGGGGATGG - Intergenic
1168436033 19:56317603-56317625 AAGCAGGATCCGAAAGTGGATGG - Intronic
927254861 2:21032246-21032268 GAGCAGAGTTTGAAAGTGGAAGG + Intronic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
929585871 2:43113991-43114013 CAGCAGAGCCATAAGGTGGAAGG + Intergenic
929652516 2:43695388-43695410 ATGTTGGGCCTGAAAGTGGAAGG + Intronic
929944531 2:46360624-46360646 AACCAGAGCCTGGATGTGGAAGG - Exonic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930442214 2:51423635-51423657 AAGAAAAGCCTGAAACTTGATGG + Intergenic
930454772 2:51592889-51592911 AAGAATAGCCTGAACCTGGAAGG + Intergenic
930485798 2:52009053-52009075 AAATAGAGCTAGAAAGTGGAAGG - Intergenic
935168387 2:100589779-100589801 AAGGACAGCCCGGAAGTGGAGGG - Intergenic
935288578 2:101588991-101589013 AAGCATAGACTGAAAGTGGAGGG - Intergenic
935337587 2:102031436-102031458 AGGCAGAGTCTGAAAGCCGATGG - Intergenic
935562644 2:104574870-104574892 AAGCAGAGAGGGAAAGTGGGTGG - Intergenic
935719244 2:105965809-105965831 GAGCAGAGCTGGAAAGTCGATGG - Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936502037 2:113074247-113074269 ATTCAGAGCATGGAAGTGGAAGG + Intronic
937126534 2:119478387-119478409 CAGCAGGGCCTGACAGTGGAAGG + Intronic
938672677 2:133600767-133600789 AAGCAGAGCCTGAGCGGGGATGG - Intergenic
938952767 2:136270861-136270883 ATACATAGGCTGAAAGTGGAGGG + Intergenic
938981410 2:136530726-136530748 AAGTGCAGCCTGAAAGTGCAGGG + Intergenic
939317444 2:140569340-140569362 AAACATAGACTGAAAGTGAAGGG + Intronic
939387721 2:141522397-141522419 AAGGAGAGCCTGAATGTGGCAGG + Intronic
939956189 2:148529453-148529475 AAGGAGAGGCTGAAGGTGCACGG - Intergenic
941869315 2:170367087-170367109 GGGCAGAGACTGAAGGTGGAAGG - Intronic
943746036 2:191463631-191463653 ATGCAGAGCTGGAAAGCGGATGG + Intergenic
944329989 2:198454265-198454287 AAGAACTGCTTGAAAGTGGAAGG - Intronic
944429536 2:199618001-199618023 AATCAGAACATGAATGTGGAAGG + Intergenic
945080083 2:206079723-206079745 AAGCAGACCCTGAAAGTCTTTGG - Intronic
945223543 2:207508595-207508617 CAGCAGAGCAACAAAGTGGAAGG + Intergenic
946662540 2:222016555-222016577 GAGCAAAGACTGAAAGGGGAGGG - Intergenic
946936285 2:224724399-224724421 AACCAGAGGCTGAAAAGGGAAGG - Intergenic
947394637 2:229674611-229674633 AAGCAGAGTGTGAAGGTGGCTGG - Intronic
947469680 2:230389429-230389451 AAGCAGAGAATAAAAGTAGAAGG + Intronic
947561455 2:231157394-231157416 AAACAGAGGCTGAAAGAGGAAGG - Intronic
947880383 2:233504416-233504438 AAACATAGACTGAAAGTGAAGGG + Intronic
948518614 2:238521992-238522014 AAGCAGAGCCTGGAAATGGAGGG - Intergenic
1169505367 20:6205375-6205397 ACACATAGCCTGAAAGTGAAGGG - Intergenic
1169707512 20:8522309-8522331 AAGCAGAGCCTGAGATGGGGAGG - Intronic
1170667358 20:18398405-18398427 AAGCAGAGCAGGAAAGGGAAAGG + Intronic
1172015626 20:31870797-31870819 AGGCAGAGCCGGAAGGGGGACGG - Intronic
1172194276 20:33081514-33081536 AAGCAGTGCCAGCATGTGGATGG + Exonic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1173188448 20:40858712-40858734 GACCAGAGCCTGAGAGGGGAAGG + Intergenic
1174590362 20:51640213-51640235 AAGGAGAGCCTGAAGGCGAAGGG - Intronic
1174863111 20:54111124-54111146 AAGCACAGCCTCAGAGAGGAGGG - Intergenic
1174940437 20:54920580-54920602 AGGCAGAGGCTGAAAGTGGGAGG + Intergenic
1175563650 20:59954837-59954859 AGGCAGAGCCTGGAAGAGGGAGG - Intergenic
1176093892 20:63330820-63330842 AGGAAGAGCCTGCAGGTGGAAGG + Exonic
1178096057 21:29217049-29217071 AAGGAGTGCCAGGAAGTGGAAGG + Intronic
1178910766 21:36671564-36671586 AAGCTGAGCCTGAAAGAGGATGG + Intergenic
1179351877 21:40618860-40618882 GAGCAGCGCCTGGAGGTGGAAGG + Intronic
1180137629 21:45871517-45871539 AAGCAGAACCTGGCAGGGGAGGG - Intronic
1181487268 22:23239175-23239197 AAGGAGAGTCTGAAAGTGCAGGG + Intronic
1181632343 22:24157779-24157801 AAGCGGAGCCAGGAAGGGGATGG - Intronic
1184520396 22:44990470-44990492 ACGCACAGCCTGAAAAAGGAAGG + Intronic
949921943 3:9009951-9009973 GAGCAGACCCTCAAAGGGGAAGG + Intronic
950844802 3:16004538-16004560 AAGCAGAGTCTGAATGCAGAAGG - Intergenic
951281995 3:20762553-20762575 ACGCATAGTCTGAAAGTGAAGGG + Intergenic
951804003 3:26625137-26625159 AAGAAAAGCCTGCACGTGGAAGG - Intronic
952196025 3:31076086-31076108 CAGAAGAGACTGAAAGGGGACGG + Intergenic
952794102 3:37223722-37223744 AAGCAGATGCTGAGAGTGCAAGG - Intergenic
952982681 3:38750933-38750955 AAACAGAGCCTTAAAGTCAAAGG - Intronic
954474759 3:50733586-50733608 ACACATAGCCTGGAAGTGGAGGG - Intronic
955228596 3:57079878-57079900 ACGCAGAGCCTGAAAGTGAGGGG + Intergenic
955685286 3:61543266-61543288 AAGCAGAGCCTGGTATTTGAAGG + Intergenic
956458818 3:69451074-69451096 AAGCAGAGGCTCGGAGTGGAAGG - Intronic
957350045 3:79012887-79012909 AGGAAGGGGCTGAAAGTGGAGGG + Intronic
961073848 3:123963572-123963594 AAACAGAACCTGAAGCTGGAGGG - Intergenic
961309713 3:125988239-125988261 AAACAGAACCTGAAGCTGGAGGG + Intergenic
961314773 3:126026945-126026967 GAACAGAGCCTGGAAGGGGAGGG - Intronic
961500699 3:127331924-127331946 ACATAGAGCCTGAAAGTGAAGGG + Intergenic
962499393 3:135974660-135974682 AAGCAGAGTTTGAAAGGGAAGGG - Intronic
962559026 3:136586935-136586957 AAGAAGAGCCAGAAAATGGAGGG + Intronic
962916221 3:139906219-139906241 AATGAGAGCAAGAAAGTGGAAGG - Intergenic
962996109 3:140630238-140630260 TAGTAGAGCCTGAAAGTATAGGG - Intergenic
963068453 3:141282218-141282240 ATACAGTGCCTGAATGTGGAAGG - Intronic
965099279 3:164276195-164276217 ATACAGACGCTGAAAGTGGATGG + Intergenic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
966269526 3:178088013-178088035 AAGCACAGTCTGAAAATGAAGGG + Intergenic
966833710 3:184032865-184032887 GAGCAGAGACTGAGAGAGGAGGG - Exonic
966850084 3:184159258-184159280 AAGAAGAGTCTGCAGGTGGAAGG - Intronic
966891287 3:184409390-184409412 ACGCAGACACTGCAAGTGGACGG + Intronic
967279813 3:187811037-187811059 CAGGAGAGCCAAAAAGTGGAAGG + Intergenic
967498195 3:190165644-190165666 AAACATAGCCTGAAAGTGAAGGG + Intergenic
967940501 3:194762679-194762701 AAGCAGGGCCTGGTAATGGATGG + Intergenic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
970764177 4:19526846-19526868 AAACATAGACTGAAAGTGAAGGG - Intergenic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971732580 4:30404844-30404866 AAGCAGAGGTATAAAGTGGAGGG - Intergenic
972140678 4:35955893-35955915 AAGCAGAGGCTTAAAGTAAAGGG - Intronic
973144619 4:46810100-46810122 ATACAGAGGCTGAAAGTGAAGGG - Intronic
974067067 4:57088455-57088477 AAGCAGAAACTGAGAGTGGTAGG - Intronic
975411539 4:74057779-74057801 AAGCATGGGCTGAAAGTGGGAGG + Intergenic
975777192 4:77799935-77799957 AGGCAGAGCCCGAAATTGGAAGG - Intronic
977730214 4:100342059-100342081 AAGTACAGCATGAAAGTGGCAGG + Intergenic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
978214293 4:106180092-106180114 ATGCAGAGACTAAAAGTGAAGGG - Intronic
980175055 4:129334462-129334484 AAGCAGAGGCCAAAAGAGGATGG + Intergenic
980347134 4:131635747-131635769 AAGTAGTACCTGAAAATGGAAGG + Intergenic
981178103 4:141705941-141705963 TAACACAGACTGAAAGTGGAGGG - Intronic
981283475 4:142988333-142988355 ACACAGAGGCTGAAATTGGAAGG - Intergenic
981786376 4:148483788-148483810 CAGCAGAGCCACAAGGTGGAAGG - Intergenic
982513724 4:156317963-156317985 AAGCAAAGCCTTAAAAGGGATGG + Intergenic
983563896 4:169129669-169129691 AAGCAGGTCCTGAAGGTGAATGG - Intronic
983666108 4:170186062-170186084 ATGCATAGACTGAAAGTGAAGGG - Intergenic
983886732 4:172988470-172988492 AAGCAGAGCATAAAAGTTTAGGG + Intronic
984054259 4:174907111-174907133 ACACATAGCCTGAAAGTGAAGGG - Intronic
984278642 4:177640202-177640224 AAGCAGAGCCAGAAAGGGAGAGG - Intergenic
985051459 4:185996221-185996243 AAGCAGATCCTGAAGGTGTCAGG + Intergenic
985527233 5:412420-412442 AAGCAGCTCCAGAAAATGGAAGG + Intronic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
989437531 5:41432426-41432448 AAGAAGGGGATGAAAGTGGATGG + Intronic
991013749 5:61910507-61910529 AAGCACTACCCGAAAGTGGACGG - Intergenic
991624274 5:68583063-68583085 AAACAGAGATTTAAAGTGGAGGG + Intergenic
992432973 5:76727588-76727610 GAGCAGAGCCTGGTAGTGTAGGG - Intronic
994549594 5:101213982-101214004 ATACAGAGCCTGAAAGTGATAGG + Intergenic
997106276 5:131022791-131022813 AAGCAGAGGATGAGAATGGATGG - Intergenic
997358840 5:133281607-133281629 AACCAGAGAATAAAAGTGGAAGG + Intronic
997404991 5:133638566-133638588 AAGCAGGGTCTGGAAGAGGAGGG - Intergenic
997844645 5:137275715-137275737 CAGCAGACCCTGAAAGTGGTAGG - Intronic
998177207 5:139909214-139909236 TGGCACAGCCTCAAAGTGGAAGG - Intronic
998914164 5:146996330-146996352 AATCAGAGTTTGAAAGTGTAGGG + Intronic
999128821 5:149266995-149267017 AAGCAGGCCATGCAAGTGGAGGG - Intergenic
999801553 5:155042884-155042906 AAGCAGAGCCAGGAAGAGTAGGG - Intergenic
999904232 5:156121803-156121825 AAGCAGGGGCTGAGAGTTGAGGG + Intronic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1000700931 5:164448737-164448759 TAGCAGAGCCTTAAACTGGTTGG - Intergenic
1000807865 5:165819570-165819592 AAGGAGAGCCTGGAACTGGGAGG - Intergenic
1001792868 5:174474902-174474924 ACCCACAGCCTGAAAGTGAAGGG + Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1004777405 6:18863332-18863354 AAGCATAGTGTGAAAGTGGAGGG - Intergenic
1006699466 6:35960226-35960248 AAGCAGAGGGTGAAAATGGGAGG - Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007341219 6:41192578-41192600 AGGCAGAGCCAGAAAGGGGCTGG - Intronic
1007412785 6:41674606-41674628 CAGGAGACTCTGAAAGTGGAAGG - Intergenic
1010365375 6:75044570-75044592 AAACACAGGCTGAAAGTGAAAGG + Intergenic
1010613919 6:77990493-77990515 CAGGAGAGCCGGAAAGGGGAGGG - Intergenic
1010780185 6:79936851-79936873 AAACAGATCCTGAAGGTGGTGGG + Intronic
1010785831 6:80000086-80000108 TAGCAGAGACTGAAAATGTATGG + Intergenic
1010824299 6:80453869-80453891 AAGAAGAGAATGAAAATGGAGGG - Intergenic
1011616613 6:89203281-89203303 AAGGGGAGCCTGAAAGGAGACGG - Intronic
1011720900 6:90155683-90155705 AAACAGAGCAGGAAAGAGGAGGG - Intronic
1012769039 6:103405280-103405302 AAGGAGAGCTGGAAAGGGGATGG + Intergenic
1013116621 6:107108403-107108425 AAGCTGAGGCTCAAGGTGGAAGG + Intronic
1013599095 6:111687538-111687560 AGGCAGAGCCTCCATGTGGAAGG + Intronic
1013653799 6:112224452-112224474 AAGCAGAGCCAGACGATGGATGG - Intronic
1013885161 6:114955565-114955587 ATGCATAGACTGAAAGTGAAAGG - Intergenic
1014384102 6:120779824-120779846 AAGCAGAGCTTGAACCTGCAGGG - Intergenic
1015590006 6:134814046-134814068 AGGCAGAGCCTCAAGATGGAAGG + Intergenic
1016806680 6:148218967-148218989 ATGCTCAGCCTGAAAGTGGATGG + Intergenic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1017999844 6:159569403-159569425 ATGCAGATCCTGAAAGTTAAAGG + Intergenic
1018040757 6:159919749-159919771 GAGCAGAGCCTGGAAGTGGGAGG + Intergenic
1018281327 6:162188560-162188582 AAGAAGATCCTGAAATTAGAAGG - Intronic
1018433763 6:163743655-163743677 AAGCACTGCCTGAAAGGAGAAGG - Intergenic
1018503702 6:164441597-164441619 AGGCAGGGGCTGACAGTGGATGG + Intergenic
1018636716 6:165867298-165867320 ACACATAGACTGAAAGTGGAGGG + Intronic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1019545255 7:1571070-1571092 TAGCAGAGGCTGAAAGTGATTGG + Intergenic
1021144501 7:17068288-17068310 ACGCAGAGGCTGAAAGGGGTGGG + Intergenic
1022240832 7:28511241-28511263 AAGCAGAGACCCAAAGTGGGAGG + Intronic
1022490964 7:30817307-30817329 AAGGAGAGCAGGAAAGTGAAAGG + Intronic
1022495001 7:30847353-30847375 AAGCAGAGCCTGTAGGATGAGGG + Intronic
1023844077 7:44111424-44111446 GAGCAGGCCCTGGAAGTGGAAGG + Intronic
1023861399 7:44219566-44219588 CAGCAGAGCCTGGGGGTGGATGG - Intronic
1024343568 7:48290984-48291006 AAGCAGAGTGTGAAAGTCCAAGG + Intronic
1025170756 7:56754435-56754457 AAGCAGAGCCTGACCCTGGCAGG - Intergenic
1025701128 7:63821264-63821286 AAGCAGAGCCTGACCCTGGCAGG + Intergenic
1025712987 7:63928537-63928559 AAGCAGAGGATGGGAGTGGATGG + Intergenic
1026323100 7:69284464-69284486 CAGTTGAGCCTGAAAGGGGAAGG - Intergenic
1026665095 7:72335353-72335375 AAGCAGAACCTGAAAATGCTAGG + Intronic
1030776517 7:113539733-113539755 ACACAGAGGCTGAAAGTGAAAGG + Intergenic
1031258071 7:119482076-119482098 AAGCAGAGCTGGAGAGGGGATGG - Intergenic
1031993009 7:128210114-128210136 GTGCAGAGCCTGAGAGGGGAAGG + Intergenic
1032153050 7:129446579-129446601 AGGCACCACCTGAAAGTGGATGG - Intronic
1032841723 7:135719447-135719469 GGGCAGGGCTTGAAAGTGGAGGG - Intronic
1035602881 8:907528-907550 AATTAGAGCCTGGAAATGGAGGG - Intergenic
1036443438 8:8801363-8801385 AAACAGAGCACGAAGGTGGAAGG + Intronic
1037636140 8:20702388-20702410 AAGCAAAGCCAGAAAGAGAAGGG + Intergenic
1037941970 8:22958407-22958429 AAGGAGAGCTTGAAACTTGAAGG + Intronic
1038815331 8:30897288-30897310 AGATAGAGCCTGAAAGTGGTAGG - Intergenic
1038897478 8:31801864-31801886 AACTTGAGCCTCAAAGTGGAAGG - Intronic
1039687814 8:39825196-39825218 AAGCAAAGACTTAAAGTAGATGG - Intronic
1040662610 8:49593793-49593815 AACCAGCACCTGAACGTGGAAGG + Intergenic
1040825664 8:51618240-51618262 AAGCAAAGTCTGAAAGGCGAGGG + Intronic
1041746285 8:61212178-61212200 AAGTAGAGCATGGAACTGGAGGG - Intronic
1042363434 8:67908681-67908703 AAGAAAATCCTGAAAATGGAAGG + Intergenic
1043023565 8:75037484-75037506 ATGGATATCCTGAAAGTGGATGG + Intergenic
1044016833 8:87055770-87055792 AAGCAGAGAGTGAAAGAGAAAGG - Intronic
1044451514 8:92340641-92340663 ATGCATAGGCTGAAAGTGAAGGG - Intergenic
1044509875 8:93062536-93062558 AATCATAGGCTGAAAGTGAAAGG + Intergenic
1045243342 8:100421676-100421698 AAGCAGAGATTGAACGTGGAAGG + Intergenic
1046670904 8:117055113-117055135 AATCAGAGCTTGAAAGTGCGGGG + Intronic
1048855714 8:138685196-138685218 ATGGAGAGCCGGTAAGTGGAAGG - Exonic
1049546473 8:143233999-143234021 GGGCAGAGCATGAAGGTGGATGG - Intergenic
1050063869 9:1738239-1738261 AAGTAGAAGCTGAAAGTGCAAGG - Intergenic
1050321308 9:4455395-4455417 AAGAAGAGGATGGAAGTGGAAGG + Intergenic
1050701616 9:8346095-8346117 AAGGAGAGCCTGAGAGTGGGAGG - Intronic
1050877205 9:10653567-10653589 ACACAGAGACTGAAAGTGAAGGG + Intergenic
1050912264 9:11086431-11086453 AAACAGGGCCTGAAATTGGGAGG + Intergenic
1051709551 9:19917171-19917193 AAACAAAACCTGAAAGTAGAGGG - Intergenic
1052442910 9:28521077-28521099 CAGTAGAGCCTAAAATTGGAGGG + Intronic
1052473113 9:28924963-28924985 AAACATAGACTGAAAGTGAAGGG - Intergenic
1052538977 9:29782099-29782121 GAGCACAGCCAGAAACTGGAAGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054720221 9:68596259-68596281 AGACAGAGCCAGAAAATGGATGG - Intergenic
1055446849 9:76393010-76393032 AATCTGAGCCGGAAAATGGAAGG - Intronic
1056117471 9:83454815-83454837 AAACAGAGCCTGACAGAGGGTGG - Intronic
1056248783 9:84726625-84726647 AAGCAGTGCCTGAGAGGGAAGGG + Intronic
1056406633 9:86282011-86282033 AAGCAGAGGCTGAACGTGCCCGG - Intronic
1057293024 9:93819167-93819189 AAACACAGCCTTAAAGTGGCTGG + Intergenic
1057325454 9:94059340-94059362 TGGCAGAACTTGAAAGTGGAGGG + Intronic
1058823762 9:108756564-108756586 AAACAGGGCCTGAAAGAGAATGG - Intergenic
1058893741 9:109382610-109382632 CAGCTGAGCCTGAGAGGGGATGG - Intronic
1059319355 9:113456120-113456142 AAGAAAGGCCTGAAAGGGGAAGG - Intronic
1059985657 9:119818053-119818075 TTGCAGAGGCTGAAAGGGGATGG - Intergenic
1060236537 9:121867618-121867640 AGGGAGAGCCTGAGAATGGATGG - Intronic
1060656206 9:125374342-125374364 CAGCAGGGCCTGAATTTGGAAGG - Intergenic
1060748726 9:126154962-126154984 AAGGTGAGCCTGAAAGGGAATGG + Intergenic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1186647586 X:11523766-11523788 AAGTAGAACCAGCAAGTGGAGGG + Intronic
1186649874 X:11547765-11547787 CAGCAGTTCCTGAAATTGGATGG - Intronic
1186864488 X:13705951-13705973 AAGCAGAGACTGTGAGGGGAAGG + Intronic
1187429671 X:19210772-19210794 GCGCAGAACCTGAATGTGGAAGG + Intergenic
1187792991 X:22971015-22971037 AAGAAGAGCCTCTGAGTGGAGGG + Intergenic
1187957525 X:24534463-24534485 ATGCAGAGACACAAAGTGGAAGG + Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190263452 X:48814098-48814120 GAGCTGAGCCTGAAATTGGGTGG + Intronic
1190765464 X:53472633-53472655 ACACAGACCCTGAAAGTGGCAGG - Intergenic
1190946953 X:55104374-55104396 ACACATAGCCTGAAAGTGAAGGG + Intronic
1191725322 X:64273733-64273755 ACACATAGGCTGAAAGTGGAGGG + Intronic
1191909745 X:66136424-66136446 AAGAAGAGCCTGAAACCTGATGG - Intergenic
1192312240 X:70026797-70026819 AAGCAGAGACAGAGAGTAGAGGG - Intronic
1192945086 X:75957676-75957698 GAGCAGAATCTGAAAGTAGAGGG - Intergenic
1194423044 X:93700442-93700464 AAGCTGAGATTGAAACTGGATGG - Intronic
1195046405 X:101058427-101058449 AAGGACAGCTTGAAAGTTGAAGG - Intergenic
1195921878 X:109991959-109991981 AAGCACAGCCTGAATTTGTAAGG + Intergenic
1196170294 X:112579934-112579956 AAGCAGGGCCAGATAGTAGAGGG - Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1198987330 X:142470344-142470366 AAACAGAGACTGAAAATGCATGG - Intergenic