ID: 1165933845

View in Genome Browser
Species Human (GRCh38)
Location 19:39377320-39377342
Sequence CTGCAAGCCCACAAACATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165933845_1165933850 14 Left 1165933845 19:39377320-39377342 CCTATATGTTTGTGGGCTTGCAG 0: 1
1: 0
2: 1
3: 16
4: 130
Right 1165933850 19:39377357-39377379 TTCTCTATGTGCTGGAACCCAGG 0: 1
1: 0
2: 2
3: 14
4: 139
1165933845_1165933848 6 Left 1165933845 19:39377320-39377342 CCTATATGTTTGTGGGCTTGCAG 0: 1
1: 0
2: 1
3: 16
4: 130
Right 1165933848 19:39377349-39377371 TACATGCCTTCTCTATGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 173
1165933845_1165933851 15 Left 1165933845 19:39377320-39377342 CCTATATGTTTGTGGGCTTGCAG 0: 1
1: 0
2: 1
3: 16
4: 130
Right 1165933851 19:39377358-39377380 TCTCTATGTGCTGGAACCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165933845 Original CRISPR CTGCAAGCCCACAAACATAT AGG (reversed) Intronic
906564518 1:46789175-46789197 GTGCATGCACACAAACATCTCGG - Intronic
909710557 1:78644761-78644783 CTCCCAGCCAACACACATATAGG - Exonic
910282551 1:85517518-85517540 CTGCAAGCTCACCAAAATATTGG + Intronic
910737519 1:90477019-90477041 CTGGAAGCCCACAAACCAAAGGG + Intergenic
914207539 1:145546372-145546394 CTGCAAGCTCACCAAAATATTGG - Intergenic
915864249 1:159481426-159481448 CTGCAAGCCAACAAACACCAAGG + Intergenic
918587978 1:186209715-186209737 CTGCAAGCCTAAAAACATCAAGG + Intergenic
919023650 1:192140358-192140380 ATGAAAGCCCACAGAAATATGGG + Intergenic
921991855 1:221375377-221375399 CTGCAAGCAGACAAATTTATAGG - Intergenic
1062933933 10:1371809-1371831 CTGCATCCACACAAACATGTTGG - Intronic
1065399797 10:25286100-25286122 ATGCATGCACACACACATATAGG - Intronic
1065767827 10:29048106-29048128 CTGCAAGGCCACACACACAGTGG + Intergenic
1067965652 10:50909842-50909864 CTGAACGCCCACAAGCAGATTGG - Intergenic
1070725847 10:78789479-78789501 CTGCAAGCCCAGAAACAGACTGG - Intergenic
1075053805 10:119203346-119203368 CTGGAAAGCCACAAACCTATCGG - Intergenic
1076414894 10:130278802-130278824 CTCCAGGCCCACAAACAAATAGG + Intergenic
1077580505 11:3414335-3414357 CTGCAAGCCAGCAGACAAATCGG - Intergenic
1077604594 11:3600349-3600371 CTGCATGTCCACAACCATCTTGG + Intergenic
1081121817 11:39276207-39276229 CTGCAAGCTGACAAACTTCTTGG + Intergenic
1081196074 11:40162280-40162302 CTGCAAACGCTCAAACATTTTGG + Intronic
1083980642 11:66165663-66165685 CCAAAAGCCCAGAAACATATTGG + Intronic
1084227051 11:67723164-67723186 CTGCATGTCCACAATCATCTTGG + Intergenic
1084237436 11:67797164-67797186 CTGCAAGCCAGCAGACAAATTGG - Intergenic
1084260487 11:67974937-67974959 CTGCATGTCCACAATCATCTTGG + Intergenic
1084808142 11:71593692-71593714 CTGCATGTCCACAATCATCTTGG - Intronic
1084845256 11:71893705-71893727 CTGCATGTCCACAATCATATTGG - Intronic
1086444256 11:86857757-86857779 CTGCATGTCCACAATCATCTTGG + Intronic
1087043253 11:93821993-93822015 CTGAAAGCTAACATACATATAGG + Intronic
1087176376 11:95099790-95099812 CTGCCATCTCACAAACATAGAGG - Intronic
1088992310 11:114964283-114964305 CTGCAAGAACTCAAACAAATCGG - Intergenic
1088992647 11:114967516-114967538 CTGCAAGCACTCAAACAAATCGG - Intergenic
1090455124 11:126842479-126842501 CTGCAAGACCATGACCATATTGG + Intronic
1092431749 12:8415485-8415507 CTGCATGTCCACAATCATCTTGG + Intergenic
1092434700 12:8438105-8438127 CTGCATGTCCACAATCATCTTGG + Intergenic
1093926067 12:24909614-24909636 CTGCAAGCCAAGAAACACCTGGG - Intronic
1096108191 12:49011282-49011304 CCACAGGCCCATAAACATATTGG + Intronic
1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG + Intergenic
1100165335 12:91911294-91911316 CTGCATGCTCACAAACAAACTGG + Intergenic
1104643422 12:130481544-130481566 CTGCACCCCCACAGACATCTGGG + Intronic
1107769646 13:43776126-43776148 CTGAAAGCCAACATACATTTAGG + Intronic
1109839370 13:67902491-67902513 CTGCATGTCCACAATCATCTTGG - Intergenic
1110453261 13:75660970-75660992 ATGCAAGACCACAGACATTTTGG + Intronic
1112386483 13:98944858-98944880 CAGCAACCACAGAAACATATTGG - Intronic
1116246236 14:42416406-42416428 CTACATGCACACAAACATAATGG + Intergenic
1116663964 14:47750833-47750855 CTAGAAGCCAACAAACATTTTGG - Intergenic
1121466502 14:94118850-94118872 CTGCCAGCCCACAAGAAAATGGG + Intergenic
1125796085 15:42404919-42404941 CTGCAAACCCAAAAGCTTATGGG + Intronic
1127250586 15:57232883-57232905 CTGAAAGTCCACAAACTTTTAGG - Intronic
1133405485 16:5521113-5521135 CTGCAACCACCCAAACAGATAGG - Intergenic
1133600704 16:7337604-7337626 CTGCAAGCTCACAAAAGAATGGG + Intronic
1134017935 16:10902182-10902204 CTCCAAGCCCCCTAACATACTGG - Exonic
1139779106 16:69336067-69336089 GTGCCAGCCCACAAAGATCTGGG - Intronic
1142733360 17:1878361-1878383 CTGCCATCACACAAACATTTTGG - Intronic
1143190956 17:5039801-5039823 CTGCAAGGTCCCTAACATATAGG - Intronic
1145887233 17:28390853-28390875 CTGAAAGCCCACATACATCTTGG + Intronic
1145890869 17:28414747-28414769 CTGCAAGCTCGAAAACCTATAGG - Intergenic
1146350841 17:32092177-32092199 TTGCAAGCACACACACACATAGG + Intergenic
1156494864 18:37519084-37519106 CTGAGAGCCCACAGACAGATGGG + Intronic
1160039221 18:75330511-75330533 CTAGAAGCAAACAAACATATTGG + Intergenic
1160979422 19:1810101-1810123 CTGCATGCCCAGAAAGATCTGGG - Intronic
1163813111 19:19447089-19447111 GTGGAAGCCCACAAACAGAGAGG + Intronic
1163967306 19:20758785-20758807 CTACAAACCCCCAAATATATTGG + Intronic
1165933845 19:39377320-39377342 CTGCAAGCCCACAAACATATAGG - Intronic
1167831527 19:52026834-52026856 GTGCACGCACACAAACATTTCGG - Intronic
931222348 2:60298909-60298931 CTGCATGCACACCCACATATAGG + Intergenic
932354214 2:71055427-71055449 CTGCATGTCCACAATCATCTTGG - Intergenic
933537834 2:83599462-83599484 CAGCAAGCCCACAAACCCACTGG - Intergenic
934590619 2:95546822-95546844 CTGCATGTCCACAATCATCTTGG - Intergenic
936010694 2:108923540-108923562 CTGCAGGCCCACAATCAAGTCGG + Intronic
938129329 2:128697710-128697732 CAGCAAGACCACAAACCCATCGG - Intergenic
938291945 2:130155202-130155224 CAGAAAGCCCACAAACAACTTGG + Exonic
939587670 2:144025325-144025347 CTGCATGCCCCCTAAAATATGGG + Intronic
940870246 2:158853846-158853868 CTGCATGTCCACAATCATCTTGG - Intronic
944812861 2:203345196-203345218 CAGCGAGACCACAAACTTATCGG + Intronic
946872682 2:224098620-224098642 CTGAAAGCCCACAAGGAAATGGG - Intergenic
948302001 2:236914600-236914622 CTGCCAGACCACACACATAATGG + Intergenic
1169391072 20:5191741-5191763 CTTCAGCCCCACACACATATGGG - Exonic
1175564510 20:59962430-59962452 CTGCAAGCCAAGAAACAGCTGGG - Intronic
1177881615 21:26701955-26701977 ATGCAAGTCCAAAAACAAATAGG + Intergenic
949588863 3:5472013-5472035 CTGCATGCCCACAAAATGATTGG - Intergenic
949707645 3:6837389-6837411 CTGCAAACCCAAAAATATGTTGG - Intronic
953055065 3:39381510-39381532 CTGCATCCCCACAAACATCCAGG + Intergenic
954446347 3:50548947-50548969 CTGGAAGCCCAAAGACATGTGGG + Intergenic
956563781 3:70612942-70612964 CAGCGAGACCACAAACCTATGGG + Intergenic
957043649 3:75357196-75357218 CTGCATGTCCACAATCATCTTGG + Intergenic
957919535 3:86730929-86730951 CTGCAAGACCACAAACCCACCGG - Intergenic
959981703 3:112524895-112524917 CTGCATGTCCACAATCATCTTGG + Intergenic
960819565 3:121714182-121714204 TTCCAAACTCACAAACATATTGG - Intronic
961275739 3:125724778-125724800 CTGCATGTCCACAATCATCTTGG - Intergenic
961278660 3:125747373-125747395 CTGCATGTCCACAATCATCTTGG - Intergenic
961301446 3:125924614-125924636 CTGCAAGCCAGCAGACAAATCGG + Intergenic
961875741 3:130022261-130022283 CTGCATGTCCACAATCATCTTGG + Intergenic
962677433 3:137767328-137767350 CAGAAAGCCCACAAACCTCTAGG - Intergenic
969730090 4:8949887-8949909 CTGCATGTCCACAATCATCTTGG - Intergenic
969786255 4:9459517-9459539 CTGCATGTCCACAATCATCTTGG - Intergenic
969789694 4:9484001-9484023 CTGCATGTCCACAATCATCTTGG - Intergenic
971150098 4:24022388-24022410 CTGCCTCCCCACATACATATCGG + Intergenic
975597230 4:76060490-76060512 CTGCAAGCCTACACACCTATTGG + Intronic
976903826 4:90211246-90211268 CTGCAAGCCCAGAAATTTGTGGG + Intronic
983357880 4:166687537-166687559 TTGCAACCACACAAACACATAGG - Intergenic
984454934 4:179953654-179953676 CTGCAAGCAACCAAATATATGGG - Intergenic
988006635 5:25420599-25420621 CGGCATTACCACAAACATATGGG - Intergenic
991412408 5:66358054-66358076 CTACAAGCCAACAAACACAAAGG - Intergenic
992186540 5:74249947-74249969 ATGGAAACCCACAAACATTTTGG + Intergenic
993997370 5:94738722-94738744 CTGCTAGCCCACAGACATAATGG - Intronic
995610550 5:113905853-113905875 CAGAGAGCCCACATACATATGGG - Intergenic
998790449 5:145760925-145760947 CAGCAATGCCACAAGCATATTGG + Intronic
1001843699 5:174902481-174902503 CAGCAAGACCACAAACCTACCGG + Intergenic
1003455772 6:6280809-6280831 CTTCAAGCCCACAAATAAAGAGG - Intronic
1004550188 6:16639339-16639361 CAGCAAGACCACAAACCTATCGG + Intronic
1004934137 6:20491167-20491189 CTGGAAACTCACAAACACATTGG - Exonic
1007915606 6:45558756-45558778 CGGCAAGCCTTCCAACATATTGG - Intronic
1011870532 6:91886724-91886746 CTGCAAGTCCACAATCCAATAGG - Intergenic
1012695663 6:102379368-102379390 CTGCACTCCCACATTCATATTGG - Intergenic
1017136770 6:151154007-151154029 CTGCAAGCCGAAAAACATCAAGG + Intergenic
1019164405 6:170088529-170088551 CTGCAGGCCCAGAAACCTCTCGG - Intergenic
1020310835 7:6867360-6867382 CTGCATGTCCACAATCATCTTGG + Intergenic
1020320455 7:6935657-6935679 CTGCAAGCCAGCAGACAAATCGG - Intergenic
1022320797 7:29286086-29286108 CTGCATGCCCACAAACATGTAGG + Intronic
1028953703 7:96665307-96665329 CTGAAATCCCACTAACATATAGG - Intronic
1029077541 7:97947688-97947710 CTGCATGTCCACAATCATCTTGG + Intergenic
1030572239 7:111242352-111242374 CTGCAATTCCACAAACAAATTGG - Intronic
1030942271 7:115667840-115667862 CTGGAAGACCACAGACACATTGG + Intergenic
1034077370 7:148245213-148245235 CTGCAAGCCCACAGACCTCTGGG + Intronic
1035312428 7:157977907-157977929 CTGCCGGCCCACAGACACATCGG - Intronic
1036545549 8:9766351-9766373 CTCCAATTCCATAAACATATTGG - Exonic
1036819535 8:11929273-11929295 CTGCATGTCCACAATCATCTTGG + Intergenic
1036832705 8:12034322-12034344 CTGCATGTCCACAATCATCTTGG + Intergenic
1037355808 8:18018326-18018348 AAACAAGCCCACAAACATCTGGG - Intronic
1041223603 8:55676096-55676118 CTGCAAGCCCACAGTCATCTGGG - Intergenic
1042090264 8:65152022-65152044 CAGCGTGCCCCCAAACATATAGG + Intergenic
1053161962 9:35819386-35819408 CCCCAATCCCACAGACATATCGG - Exonic
1055726880 9:79239887-79239909 TGTCAAGCCCACAAACATAATGG - Intergenic
1055748239 9:79474521-79474543 CAGCAAGACCACAAACCCATGGG - Intergenic
1056029197 9:82534012-82534034 ATGGAAGCCCAAAAACATAGTGG - Intergenic
1056076188 9:83043274-83043296 CTACAAGCTCACAAACATCATGG + Intronic
1060083111 9:120671298-120671320 CATCAAGGCCCCAAACATATGGG + Intronic
1061486293 9:130922152-130922174 GTCCAGGCCCACAAACATCTGGG - Intronic
1185487223 X:491319-491341 CTCCAAGCTCACAAACACACAGG + Intergenic
1186654704 X:11600365-11600387 CTCCAAGCCCAGAAACAAATAGG + Intronic
1188115604 X:26238913-26238935 CTGCAGGCCCAACACCATATAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1196192186 X:112806294-112806316 GTGTAAGCACACAAGCATATTGG - Intronic
1196526386 X:116731956-116731978 CTCCAAGCACAAAAACTTATTGG - Intergenic
1197875973 X:131107066-131107088 GTGCATGCACACACACATATGGG + Intergenic
1199995766 X:153025090-153025112 CTCCAAACCCACAAAGAAATGGG - Intergenic
1200081753 X:153580362-153580384 ATGCACGCACACACACATATGGG + Exonic
1200362458 X:155623110-155623132 CTGTGAGGCCACAAACATATAGG - Intronic