ID: 1165934978

View in Genome Browser
Species Human (GRCh38)
Location 19:39383717-39383739
Sequence GGGATCTCTGCTGAGGCCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165934972_1165934978 -10 Left 1165934972 19:39383704-39383726 CCAGGCCCGTCGAGGGATCTCTG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1165934978 19:39383717-39383739 GGGATCTCTGCTGAGGCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 213
1165934968_1165934978 2 Left 1165934968 19:39383692-39383714 CCTTGCTCACTCCCAGGCCCGTC 0: 1
1: 0
2: 3
3: 26
4: 396
Right 1165934978 19:39383717-39383739 GGGATCTCTGCTGAGGCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 213
1165934971_1165934978 -9 Left 1165934971 19:39383703-39383725 CCCAGGCCCGTCGAGGGATCTCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1165934978 19:39383717-39383739 GGGATCTCTGCTGAGGCCCGGGG 0: 1
1: 0
2: 1
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165934978 Original CRISPR GGGATCTCTGCTGAGGCCCG GGG Exonic
900190887 1:1351760-1351782 GGGCTATCTGTTGAGGCCCCAGG + Intergenic
900794940 1:4702237-4702259 GAGATCTCTGCTCAGGAACGAGG - Intronic
902323537 1:15684193-15684215 GGGGTCTCTGGGGAGGGCCGCGG + Intergenic
902471056 1:16647736-16647758 GGGATCTCAGCTGTCGCTCGGGG + Intergenic
902487748 1:16759712-16759734 GGGATCTCAGCTGTCGCTCGGGG - Intronic
902599673 1:17532389-17532411 GGGATGTCTGCTGAGCCAAGGGG - Intergenic
903827513 1:26156541-26156563 GGGATCTCTGGTGGGGGCTGGGG - Intergenic
904457572 1:30656825-30656847 GGCGTCTATGCTGAGCCCCGAGG + Intergenic
906598208 1:47099216-47099238 GGCATCTCTGCTGATGCTCAGGG - Exonic
907320535 1:53599415-53599437 TGGACCTCTGCAGAGTCCCGAGG - Intronic
910432422 1:87172461-87172483 GGGGTCTATGCTGAGGCCCCAGG + Intergenic
912947616 1:114097818-114097840 GGGATCACTGCTGAAGGCCTGGG - Exonic
915589078 1:156860619-156860641 GAGGTGTCTGCTGAGGCCGGAGG - Intronic
915943943 1:160136381-160136403 GGGTTCCCTCCCGAGGCCCGGGG - Intronic
917152715 1:171962003-171962025 GGGCTCTCTGCAGAGTCCTGAGG + Intronic
917688657 1:177444818-177444840 GGGCTGTCTGCTGAGCCCCATGG - Intergenic
920678705 1:208056772-208056794 GGGGGCTCGGCTGATGCCCGAGG - Intronic
921070050 1:211651052-211651074 GGGTGCTCTGCTGAGGACAGGGG - Intergenic
921440577 1:215181838-215181860 GAGCTCTCTGCTCAGGCCAGGGG + Intronic
922180267 1:223227860-223227882 GGTATCTCTGCCGAGCCCTGGGG - Intronic
922721203 1:227901195-227901217 GGGGTCTCTGCTGGGGTCTGTGG - Intergenic
922798129 1:228351565-228351587 GGGCTCTCGGCAGAGGCCAGGGG + Intronic
1063428224 10:5966038-5966060 GGGATCTGTGCTGAGGTCTGAGG - Intronic
1064040901 10:11962609-11962631 GCGATAACTGCTGAGACCCGAGG - Intronic
1064898865 10:20271610-20271632 AGGATCTGTGCTGAGGACTGGGG + Intronic
1065277148 10:24096724-24096746 GGCATTTCAGCTGAGGCCTGAGG - Intronic
1067211489 10:44263236-44263258 GAGATCTCAGCTGAGGTCTGGGG - Intergenic
1067431391 10:46248248-46248270 GGCTTCTCTGCTCAGGCCCTGGG - Intergenic
1067442017 10:46313952-46313974 GGCTTCTCTGCTTAGGCCCTGGG + Intronic
1067472363 10:46546352-46546374 GGGATTCCTGCTGAGGCAAGGGG + Intergenic
1067542418 10:47165682-47165704 TGAATCTCTGCAGAGGCCGGGGG - Intergenic
1067562526 10:47313976-47313998 GGGGTCTCTCCTGAGGTCCAAGG + Intergenic
1068771864 10:60830784-60830806 GGGCTCTCTGAAGAGTCCCGAGG + Intergenic
1069600465 10:69702659-69702681 GGGCTCTCTGCAGAGTCCTGAGG - Intergenic
1069837542 10:71318888-71318910 GGGGTCTCTGCAGCGGCCTGGGG + Intergenic
1069887448 10:71632973-71632995 GGGCTCTCTGCAGAGTCACGGGG + Intronic
1071256106 10:83873231-83873253 GGGATCTCTGATGATGACGGGGG + Intergenic
1072389081 10:94964139-94964161 GGGCTCCCTGCTGAGCCCCAGGG + Intronic
1072483290 10:95829996-95830018 GGACTCTCTGCAGAGTCCCGAGG - Intronic
1072984936 10:100131030-100131052 TGGATGTCTGCCGAGGCCCCAGG + Intergenic
1074768287 10:116716516-116716538 GGGTTTTCTGCTCAGGCCCCAGG + Intronic
1077227814 11:1445995-1446017 GGGGTCTCGGCTGAGGCCATTGG + Intronic
1077313807 11:1906700-1906722 GGGTTTTCTGCTGAGGCTGGTGG + Intergenic
1080144116 11:28958940-28958962 GGGCTCTCTGCAGAGTCCCAAGG - Intergenic
1083812339 11:65112776-65112798 GGGGGCTCTGATAAGGCCCGGGG - Intronic
1084165226 11:67372406-67372428 GGGACCTCTGGCGAGCCCCGGGG + Intronic
1084502585 11:69543675-69543697 GGACTCTCTGCAGAGTCCCGAGG - Intergenic
1085054111 11:73394159-73394181 GGGTTCTCTGCTGGGGCAGGGGG + Intronic
1085315830 11:75544414-75544436 GGAAGCTCTCCTGAGGCCAGGGG + Intergenic
1085739628 11:79067782-79067804 GGCCTCTTTTCTGAGGCCCGGGG + Intronic
1089398251 11:118149728-118149750 GGGATCTCTGCATAAGCCAGGGG - Intronic
1090354978 11:126134233-126134255 GGAATCTGTGCTGAGACCCAAGG - Intergenic
1090716581 11:129436876-129436898 GCGGTCTCTGCTGAGGCCCCAGG + Exonic
1091191632 11:133700317-133700339 GGGACCTCTGCAGAGTCCTGAGG - Intergenic
1091747274 12:3000393-3000415 GGGAACTCTGCAGAGTCCCGAGG + Intronic
1095830357 12:46579201-46579223 AGGATCTCAGCTGAGGCAGGAGG - Intergenic
1097248785 12:57621122-57621144 GGGATCCCTGCTGAGGGGCCAGG + Intronic
1101921610 12:108937617-108937639 TGGATCTGTGCTGAGGTCTGAGG - Intronic
1102446119 12:113004111-113004133 GGTTTCTCTGCTTAGGCCAGAGG + Intronic
1105314274 13:19243007-19243029 GGGATGTCTGCAGAGTCCTGTGG - Intergenic
1105950204 13:25223401-25223423 GGGAGCTCCCCTGAGCCCCGTGG + Intergenic
1107011974 13:35678793-35678815 GGCTTCTCTCCTCAGGCCCGTGG - Intergenic
1107838532 13:44432762-44432784 GGGGCCACTGCTGAGGCCCTAGG + Intronic
1108389930 13:49937145-49937167 GGGAAGTCTGCTGGGTCCCGAGG + Intergenic
1110318287 13:74134566-74134588 GGAAGCGCTGCCGAGGCCCGGGG - Intergenic
1113087415 13:106582425-106582447 GGACTCTCTGCAGAGTCCCGAGG - Intergenic
1114422810 14:22598600-22598622 GGAATCTCTCCAGAGGCCAGAGG - Intronic
1114549893 14:23526607-23526629 GGGACCTCAACTGAGGCCAGGGG + Exonic
1114560772 14:23589025-23589047 GGGACCTCAGCTGAGGCCTGTGG + Intergenic
1115985867 14:39103178-39103200 GAGGTCTTCGCTGAGGCCCGGGG - Exonic
1119509034 14:75196783-75196805 GGGCTCTGTGCTAAGGCCCATGG + Intergenic
1120910102 14:89658584-89658606 GGGATCTCCTCTGAGGCTCGGGG + Intergenic
1121886349 14:97546497-97546519 GGGAGCTCTGATGAGGCAGGTGG + Intergenic
1122213682 14:100189466-100189488 GGGCTCTCTGCAGAGTCCTGAGG - Intergenic
1122605221 14:102943632-102943654 GGGTCCTCTGCTGAGGCCTCTGG + Intronic
1122767638 14:104082827-104082849 GGGACAGGTGCTGAGGCCCGAGG - Intergenic
1122805539 14:104254708-104254730 GGGATGTCAGCTGTGGCCAGGGG + Intergenic
1122950797 14:105043443-105043465 GGGGTCTCAGCTCAGGCCCTGGG + Intergenic
1123031886 14:105455869-105455891 GGCCTCTGTGCTGAGGCCTGTGG + Intronic
1126468229 15:48980043-48980065 GCCATCTCTGCTCTGGCCCGGGG + Intergenic
1129276881 15:74451446-74451468 AGGGTCACTGCTGAGGCCTGGGG + Exonic
1130086081 15:80779349-80779371 GGCCTCTCGGCTGAGGGCCGGGG + Exonic
1131830307 15:96350653-96350675 GGGTTTTGTCCTGAGGCCCGAGG + Intergenic
1132629508 16:910351-910373 AGGTTCCCTGCTGAGCCCCGGGG - Intronic
1132859255 16:2061951-2061973 AGTATCTCTCCTGAGACCCGTGG - Exonic
1133018112 16:2954285-2954307 GGGATCTCAACCGAGGCGCGAGG + Intergenic
1133809407 16:9149516-9149538 GGTCTCTCTGCAGAGGCCTGAGG + Intergenic
1135609565 16:23854484-23854506 GACATCCCTGCTGAGGCCCCAGG - Intronic
1136105379 16:28026402-28026424 GGGACCTCAGCTGAAGCCCAAGG + Intronic
1137690938 16:50427063-50427085 GTGATCTCATCTGAGGCTCGGGG + Intergenic
1139371755 16:66473396-66473418 GGGTTCCCTGCCGAGGCCCCAGG - Intronic
1139442713 16:66976877-66976899 GACATCTCAGCTGAGACCCGAGG + Intergenic
1141596073 16:85097689-85097711 GGGCTGTCTGCTGGGGCCCCTGG - Intergenic
1141970309 16:87477408-87477430 GCCAGCTCTGCTGATGCCCGGGG - Intronic
1142272632 16:89098559-89098581 GGCATCTGTGCTGAGGTCCCAGG - Intronic
1145770050 17:27486475-27486497 AGGATCTCTGCTGAGGACACAGG + Intronic
1147663374 17:42129535-42129557 GGGTTCTCTGCTGGGTCCAGGGG - Intronic
1148108776 17:45132868-45132890 TGGTTCCCTGCTGAGGCCTGCGG - Intronic
1148744131 17:49908936-49908958 GGGAGCTCTGCTGGGGTCCGTGG - Intergenic
1149088636 17:52751255-52751277 GGCATCTCTGCGGGGGCCCAAGG + Intergenic
1149298740 17:55284965-55284987 TGGATCTCTTTTGAGGCCAGTGG + Intronic
1150130396 17:62666012-62666034 GGGATTTCTCCTGAGGGTCGAGG + Intronic
1152264821 17:79288147-79288169 GGGAGCAGGGCTGAGGCCCGGGG - Intronic
1153056193 18:949273-949295 GGGCTCTCAGCTGATGCACGTGG + Intergenic
1155607715 18:27626305-27626327 GGGCTCTCTGCAGAGTCCCAAGG - Intergenic
1157338233 18:46756728-46756750 GGGAGCTCTGCCGCGGCCAGGGG + Exonic
1157579744 18:48766712-48766734 GGGCTCTCTGCTGAGCCATGGGG + Intronic
1158169761 18:54584693-54584715 GGGAACTGTGCTCAGGCCCAGGG + Intergenic
1158965118 18:62615935-62615957 GGGATCTCTGTTGAAGTCAGTGG - Intergenic
1159932832 18:74332205-74332227 GGTCTCTCTGCTGAGTCCTGAGG + Intronic
1160905579 19:1450253-1450275 GGGATTTCCGGTGGGGCCCGCGG + Intronic
1160979543 19:1810700-1810722 GGGGTCACTGCTGTGACCCGGGG - Intronic
1161124481 19:2547980-2548002 GGGTTCTCTGCTGTGGCCCGTGG + Intronic
1162117479 19:8439750-8439772 GGGATCTGTTCTGAAGCCCATGG + Intronic
1162948525 19:14057514-14057536 GGGAGCTCCGGTGAGCCCCGCGG - Intronic
1163668140 19:18612674-18612696 GGGATCTCTGCTGGCGCTTGGGG - Intronic
1164656463 19:29925437-29925459 GGGACCTTGGCTGAGTCCCGCGG + Intronic
1165112311 19:33509565-33509587 GGGCTCTCTGCTGAGGACTGGGG - Intronic
1165120350 19:33554969-33554991 GGGACCTCTGCTGAGGCTCCTGG - Intergenic
1165934978 19:39383717-39383739 GGGATCTCTGCTGAGGCCCGGGG + Exonic
1167236456 19:48318829-48318851 AGGATCCCTGCTGAGTCCCTTGG - Intronic
1202703451 1_KI270713v1_random:4527-4549 GGGATCTCAGCTGTCGCTCGGGG + Intergenic
925125597 2:1453574-1453596 GGGGTCTCTCCGGAGGCCCAAGG - Intronic
925329435 2:3047048-3047070 GGGATCTCTGAGAAGGCCCATGG - Intergenic
926148108 2:10409260-10409282 GGGGTCTCAGCTCAGGCCCTGGG + Intronic
926680458 2:15659398-15659420 GGGTTCTTTGCTGAGGACAGAGG - Intergenic
932213056 2:69947869-69947891 GGGATATCCGCAGAGGCCAGAGG + Intergenic
938073352 2:128319463-128319485 GGGCTGTCTGCAGAGGCCTGCGG + Intergenic
938086695 2:128406534-128406556 GGGGTCTAGGCTGAGGCCCAGGG + Intergenic
938206497 2:129428742-129428764 GGGAGGTGTGCTGAGGCCTGGGG - Intergenic
938667523 2:133553995-133554017 GGGATCTCATCTGAGGCTCTGGG + Intronic
938766468 2:134463293-134463315 GGGTTCTGTGCTGAGAGCCGAGG - Intronic
940599070 2:155834785-155834807 GGAATCTCTGCAGAGTCCCAAGG + Intergenic
940866321 2:158820886-158820908 AGGTTCTCTGCAGAGTCCCGAGG - Intronic
943822933 2:192351061-192351083 GGAATCTCTGCGGAGTCCCGAGG + Intergenic
944501086 2:200360854-200360876 TGGATCTGTACTGAGGCCTGAGG + Intronic
946155299 2:217803128-217803150 AGGAGCTCTGCTGAGGTCAGAGG + Exonic
946326692 2:218988252-218988274 TGGGGCTCTGCTGAGGCCTGTGG + Intergenic
947498751 2:230657401-230657423 GGGGGCTCTGCTGAGGCCTTTGG - Intergenic
947702330 2:232244796-232244818 GGGACCTCTTCTGAGGGGCGTGG + Intronic
948570017 2:238912161-238912183 GCATGCTCTGCTGAGGCCCGTGG + Intergenic
948859283 2:240745123-240745145 GGGATTTGTACTGAGGGCCGGGG - Intronic
949018164 2:241725262-241725284 GGGGTCCCTGCTGATGCTCGGGG - Exonic
1169075215 20:2755962-2755984 GGGAGCTCTGCTGGGGTCCAGGG + Intronic
1169619780 20:7492358-7492380 GAGAACTCTGCAGAGGCCCAAGG + Intergenic
1172707524 20:36893282-36893304 GTCATCTCTGCAGAGGCCAGTGG - Exonic
1175201481 20:57280880-57280902 GGGGTCTCTGCTCAGATCCGGGG - Intergenic
1178519971 21:33281265-33281287 GGCATCTCTGCTAAGCCCTGGGG + Intronic
1178951619 21:36990258-36990280 GGGCTCTCTGCGCAGGGCCGCGG + Intergenic
1179194708 21:39154160-39154182 GGGGCCTCTGCAGAGGCCCAAGG - Intergenic
1179524032 21:41964104-41964126 GGGCTCCCTGGTGAGGCCCAAGG + Intergenic
1179732428 21:43375202-43375224 AGGATGTGTGCTGAGGCCAGGGG - Intergenic
1181167963 22:20993379-20993401 CAGAGCTCTGCTGAGGCCTGGGG + Intronic
1181855731 22:25780253-25780275 GTGGGCTCTGCTGAGTCCCGGGG - Intronic
1183669769 22:39265667-39265689 GGGAGCTGTGATGGGGCCCGGGG - Intergenic
1184394109 22:44222542-44222564 AGGCTCTCTGCAGAGTCCCGAGG + Intergenic
1185006308 22:48278814-48278836 GGGCTCCCTGCAGAGGGCCGTGG + Intergenic
1185098060 22:48822362-48822384 GGGTCCTCTGGTGAGTCCCGTGG - Intronic
1185117911 22:48948676-48948698 GGGATCTGTGCTGAGGCTCCAGG - Intergenic
1185162258 22:49237045-49237067 GGAATCTCTGCTGGGCCCTGTGG - Intergenic
1185388950 22:50548715-50548737 GGTGTTTCTGCAGAGGCCCGGGG + Exonic
1203324881 22_KI270738v1_random:4460-4482 GGGAACTGTGATGAGGCTCGAGG - Intergenic
950600966 3:14035294-14035316 GGGATCTGTGCTGTGGGCCCAGG + Intronic
950764316 3:15262022-15262044 GGGGGCTCTGGTGAGGCCCCAGG + Intronic
952933823 3:38379968-38379990 GGGCTCTCTGCAGAGTCCTGAGG + Intronic
954121266 3:48501477-48501499 GGCAGCTCTGTTGTGGCCCGTGG - Intronic
954291854 3:49654048-49654070 GAGAACTCTGCTGTGGCCCTTGG - Exonic
958784930 3:98587499-98587521 GGGGTCTCTGCAGAGTCCTGAGG + Intronic
959539889 3:107525295-107525317 GGGATCTTCGCCGGGGCCCGCGG + Intronic
961219859 3:125191166-125191188 GTGATCTCTGCTGATACCCCAGG + Intronic
961635421 3:128329911-128329933 GGGCTCTTTGCTCAGGCCCAGGG + Intronic
965977351 3:174641239-174641261 GGGATCTCAACCGAGGCCCGCGG - Intronic
967973336 3:195015356-195015378 GGATTCCCTGCTGAGGCCCAGGG - Intergenic
967975182 3:195030527-195030549 GGGTTCTCTCCTGAAGCTCGGGG - Intergenic
968770680 4:2504248-2504270 GGCATCACTGCTGTGTCCCGAGG + Intronic
969636370 4:8371731-8371753 GGCCTCTGTGCTGAGGCACGTGG - Intronic
969652716 4:8477480-8477502 GGGAGCTCTGCTGAGGCCTCTGG + Intronic
971231487 4:24803701-24803723 GGGATCTTAGCAGAGGCCAGTGG - Intergenic
973616585 4:52684919-52684941 GGGTTCTCTGGTAAGGCCCTTGG + Intergenic
975709975 4:77151302-77151324 GGGACCTCTGCTGAGGCTGGTGG - Intergenic
976091232 4:81460293-81460315 GGGTGCTCTGCAGAGGCCAGAGG + Intronic
977133077 4:93267377-93267399 GGCATTTCTCCAGAGGCCCGAGG - Intronic
977172877 4:93784358-93784380 GGAATCTCAGCTGAGGCGCTTGG - Intergenic
988732266 5:33984322-33984344 GGGATTCCTGCTGCAGCCCGTGG - Exonic
990296390 5:54405823-54405845 GGGAGCTCTCCTGAGGCTCAAGG - Intergenic
992158484 5:73977978-73978000 GGGCTCTCTGCAGAGTCCCGAGG - Intergenic
992213740 5:74505778-74505800 GGGATCCCTGCCGAGACCTGGGG - Intergenic
992478070 5:77123197-77123219 GCAATCTCTGCAGAGTCCCGAGG + Intergenic
994552379 5:101253676-101253698 GGGCTTTCTGGTGAGGCCCCTGG + Intergenic
995338283 5:111027677-111027699 GGGAACTCTGCTAAGTCCCAAGG + Intergenic
997189123 5:131914134-131914156 GGACTCTCTGCAGAGTCCCGAGG - Intronic
997518279 5:134506153-134506175 GGAGTCTGTGCAGAGGCCCGGGG - Intergenic
997659150 5:135576757-135576779 GAAATCTCTGCTGAGGCTGGGGG - Intronic
998072293 5:139207575-139207597 GGCATCTCTGCAGAGGCCATGGG - Intronic
1012135488 6:95551264-95551286 GTGCTCTCTGCTGAGGCATGTGG - Intergenic
1012550239 6:100458548-100458570 GGGACCTCTGATGAGGGCAGGGG + Intronic
1012954793 6:105557935-105557957 GGGGACTCTGCTGAGTCCCGAGG + Intergenic
1017993604 6:159511235-159511257 GGGATTTCTGCTGAGGACATGGG + Intergenic
1018714810 6:166523938-166523960 GGGATCACTGCAGAGGCACTGGG - Intronic
1018753873 6:166831277-166831299 GGGATCCCTGGTGAGGCCTCCGG - Intronic
1019162282 6:170076601-170076623 GGGCTCCCTGCTGGGACCCGTGG + Intergenic
1019298059 7:289613-289635 GTGCTCTCTGCTGAGACCCAAGG + Intergenic
1019312296 7:368778-368800 GGGCTCTGTGCTGCGGCCCCGGG - Intergenic
1022530808 7:31065804-31065826 GGGCTCTCTGCTCAGGCTGGAGG + Intronic
1023729418 7:43176519-43176541 GGGGACTCTGCAGAGGCCTGAGG + Intronic
1023984710 7:45088048-45088070 GGGACCACTGCTGGGGCCTGGGG - Intronic
1024157147 7:46637623-46637645 GGAATCTCTGCAGAGCCCCCAGG + Intergenic
1024673352 7:51616544-51616566 GGGGACTCTGCTGAGTCCTGAGG + Intergenic
1029114416 7:98229938-98229960 GGGATCTGAGCTGAGTCCTGAGG - Intronic
1029849316 7:103446026-103446048 GGGGACTGAGCTGAGGCCCGCGG - Intronic
1035224930 7:157427847-157427869 GGCATCTCTGCCGAGGCCTGGGG + Intergenic
1035439589 7:158885176-158885198 GGGGTCTCTGCCAAGGCCTGAGG - Intronic
1035667732 8:1391379-1391401 CGGATCTGTGCAGAGGCACGCGG + Intergenic
1035870496 8:3132165-3132187 GAGATATCTGCTGAGGTCTGAGG - Intronic
1038540601 8:28386698-28386720 GGGAGCTCGGCTGGGGCCTGGGG + Intronic
1040047800 8:42980955-42980977 GGACTCTCTGCAGAGTCCCGAGG - Intronic
1044666976 8:94641355-94641377 GGGATCACTGCTGGGGCCACCGG + Exonic
1045714399 8:105024868-105024890 TGCATCTCTGCTTAGTCCCGGGG - Intronic
1048342482 8:133551075-133551097 GGGATCTTTTCTGAGGCCTGTGG + Intronic
1049279825 8:141738547-141738569 GGGAGCTCTGCTGTGGGCTGGGG - Intergenic
1049746810 8:144266495-144266517 GGGGTCTCGGCTGCGCCCCGCGG - Intronic
1051297062 9:15608017-15608039 GGGAACTCTGCAGAGGTCCAAGG + Intronic
1053446762 9:38158850-38158872 GGGGTCCCTGCTGAGGCTCTTGG - Intergenic
1056427049 9:86488158-86488180 GGACTCTTTGCAGAGGCCCGAGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061399342 9:130359907-130359929 GGGATGCCTGCTGAGTTCCGGGG + Intronic
1061590440 9:131594376-131594398 AGGATCTAAGCTGAGGCCTGAGG + Intronic
1061972342 9:134051509-134051531 GGCCTCTCTGCAGAGGCCCACGG - Intronic
1061990026 9:134153752-134153774 GGGGTCTCTGGTGGGGCCCAGGG + Intronic
1062023143 9:134328548-134328570 GGGCTCTCTGCTCAGCCCTGGGG - Intronic
1192473202 X:71417262-71417284 GGAAACTCTGCAGAGTCCCGAGG - Intronic
1194657864 X:96595493-96595515 GGGATCTCTGCTGAATGCCCTGG + Intergenic
1200960465 Y:8991634-8991656 GGGCTCCCTGCTCAGGCCTGGGG - Intergenic