ID: 1165937022

View in Genome Browser
Species Human (GRCh38)
Location 19:39395557-39395579
Sequence GGGCCACAGGACCGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165937022 Original CRISPR GGGCCACAGGACCGGTGTGC TGG Intronic
900419605 1:2550108-2550130 GTGGCAGAGGACCTGTGTGCAGG + Intergenic
900462611 1:2808826-2808848 GGGCCACAGGGCCCTGGTGCTGG + Intergenic
902920661 1:19664757-19664779 GGCCCACAGGCCCGGGGTGCCGG + Intergenic
903580318 1:24365825-24365847 GGCCCACAGGGCTGGTGAGCAGG + Intronic
903854916 1:26331405-26331427 TGGACACAGAACCTGTGTGCTGG - Intronic
903907663 1:26697358-26697380 GGGCCCCAGGACGGGGGCGCCGG + Exonic
908511180 1:64850987-64851009 GGGCCGTGGGACCGGTGTGCGGG + Intronic
910195584 1:84636525-84636547 GGGCCACAGGACTGGTTGGCAGG + Intergenic
910857357 1:91708847-91708869 AGGCCACAGGACAGCTGTGCAGG - Intronic
911696049 1:100891598-100891620 GGGCCACAGAACTGGTTGGCAGG + Intronic
917855727 1:179097865-179097887 GGGCCACAGAACTGGTTGGCAGG - Intronic
918094733 1:181325349-181325371 GGGCCACAAGACCAGTCTGGGGG + Intergenic
922160430 1:223075674-223075696 GGGCCACAGAACTGGTTAGCAGG + Intergenic
1063216710 10:3932052-3932074 GGGGCACAGGGACGGGGTGCAGG + Intergenic
1065749577 10:28873673-28873695 AGGCCACAGGACCTTTGTCCTGG - Intronic
1067052868 10:43033982-43034004 AGGGCACAGGACATGTGTGCAGG - Intergenic
1067948142 10:50704182-50704204 GGGCTTCAGGAATGGTGTGCTGG - Intergenic
1069323689 10:67204862-67204884 GGGCCACATGACAGATGGGCAGG + Intronic
1071650020 10:87385486-87385508 GGGCTTCAGGAATGGTGTGCTGG - Intergenic
1071858549 10:89649596-89649618 GGGCCACAGGATGGGTTGGCAGG + Intergenic
1072279494 10:93852940-93852962 GGGCCACAGAACTGGTTGGCAGG - Intergenic
1072962227 10:99939857-99939879 GGACCACAGGACTGGTTGGCAGG - Intronic
1074235070 10:111576800-111576822 GGGCCACAGGACAGAGCTGCAGG - Intergenic
1076462361 10:130655948-130655970 GGGCCAGAGGAGAGGGGTGCAGG - Intergenic
1076629353 10:131842960-131842982 TGGCCATAGGTCCGGTGAGCTGG - Intergenic
1077485204 11:2835274-2835296 GGGCCAAAGGGCTGGGGTGCAGG - Intronic
1081530515 11:43955595-43955617 GGGCCACAGGACTGGTGGGTGGG + Intergenic
1084410816 11:69005077-69005099 GGGCCACAGGGTCTGTTTGCTGG + Exonic
1084493139 11:69489092-69489114 GGGCCACAGCCGTGGTGTGCAGG - Intergenic
1084883950 11:72191192-72191214 GGGTCACAGGACATGGGTGCTGG - Intronic
1087886576 11:103489634-103489656 GGGCCACAGGACTGATTTGGGGG + Intergenic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1090339997 11:126009366-126009388 GGACCACACGACCAGTGTGTGGG - Intronic
1090660055 11:128875726-128875748 AGGCCACAGGGCCTGTGTGGAGG - Intergenic
1091680680 12:2524612-2524634 GGGCCTGAAGACCGGTGTGGTGG - Intronic
1091839195 12:3607360-3607382 GGGCCACACAACTTGTGTGCAGG + Intronic
1092238991 12:6826256-6826278 GAGCCACAGGACCAGGGAGCCGG + Exonic
1096636877 12:52965692-52965714 GGGGCACAGGAGCGGTGCCCTGG - Intergenic
1098123878 12:67269906-67269928 AGGCCAGCGGACCGGTGGGCTGG - Intronic
1100367477 12:93935076-93935098 GGGCCACAGGAGCAGTTGGCAGG - Intergenic
1101997272 12:109534219-109534241 CGGCCACAGCACCGGTGAGGAGG + Intronic
1102491128 12:113290173-113290195 GGGCAACAGGACCGTGGTGGAGG + Exonic
1104800527 12:131552441-131552463 GGGCCACAGGAGCAGTTGGCAGG + Intergenic
1106439563 13:29754023-29754045 GGGCCACAGGACTGGTTGGCAGG + Intergenic
1108507304 13:51124131-51124153 GGGCCACAGAACTGGTTGGCAGG - Intergenic
1109594381 13:64530777-64530799 GGGCCACAGAACTGGTTGGCAGG - Intergenic
1113271958 13:108684193-108684215 ATGCCACAGGAGGGGTGTGCAGG + Intronic
1113937982 13:114005315-114005337 GGGCCACAGGACGGGGTTGGTGG + Intronic
1114633908 14:24176911-24176933 GGACCTCAGGCCCTGTGTGCAGG - Intronic
1117440244 14:55752879-55752901 GAGCCACAGGACCTCAGTGCTGG + Intergenic
1117445567 14:55800796-55800818 GGGCCACAGGACTGGTTGGCAGG - Intergenic
1122263159 14:100534654-100534676 GGCCCACAGGCCCTGTGTTCTGG + Intergenic
1122499948 14:102190711-102190733 AGGCCACAGGCCAGGTGTGGTGG + Intronic
1124254512 15:28130058-28130080 GGGGCACAGGCCAGGTGTGGTGG - Intronic
1125508802 15:40282073-40282095 CGGCCACGGGACCTGTGTGCAGG - Exonic
1128388219 15:67165436-67165458 GGGCCACAGGACTGATGTCGGGG - Intronic
1129740765 15:77988574-77988596 GCCCCGCAGGGCCGGTGTGCAGG - Intronic
1130273877 15:82466558-82466580 GGGCCTCAGGGCGGGAGTGCAGG - Intergenic
1130466225 15:84193932-84193954 GGGCCTCAGGGCGGGAGTGCAGG - Intergenic
1130498038 15:84479604-84479626 GGGCCTCAGGGCGGGAGTGCAGG + Intergenic
1130588519 15:85198525-85198547 GGGCCTCAGGGCGGGAGTGCAGG - Intergenic
1132727452 16:1345144-1345166 GGGCCCCAGGACCTGTGAGGGGG + Intronic
1132752475 16:1465148-1465170 GGGCCCCAGGGCCGGGGTTCAGG - Intronic
1133063750 16:3191797-3191819 GGGCCACAGGATGGGTGTGAGGG + Intergenic
1133076323 16:3283608-3283630 GGGCCACGGGGCCGGCGTGGCGG + Exonic
1134111161 16:11516252-11516274 GGGCCACACGCCCAGAGTGCAGG + Exonic
1134872561 16:17665308-17665330 AGGCCACAGGACTGGTTGGCAGG - Intergenic
1135638002 16:24095421-24095443 GGGCCACAGGACTAGTTGGCAGG + Intronic
1138216274 16:55207749-55207771 GGGCAACAGGACCTGGGTGGTGG - Intergenic
1139014829 16:62677486-62677508 GGGCCACAGAACTGGTTGGCAGG - Intergenic
1139568790 16:67797379-67797401 TGGCCACAGGCCAGGTGTGGTGG + Intronic
1139962576 16:70726329-70726351 GGGCAACAGGGCCGGTGCACTGG + Intronic
1140426636 16:74866664-74866686 GGGTCACAGGACTGGTTGGCTGG + Intergenic
1140793463 16:78413778-78413800 GGGCCAAAGGACTGGTTGGCAGG + Intronic
1141976093 16:87517569-87517591 GCTCCACAGGGCTGGTGTGCTGG - Intergenic
1142199926 16:88756193-88756215 AGGCCACAGGGAGGGTGTGCAGG + Intronic
1142247682 16:88977299-88977321 CGGCCCCAGGGCAGGTGTGCAGG + Intergenic
1148648728 17:49234348-49234370 GGGCCACAGAACTGGTTGGCAGG + Intergenic
1149308884 17:55374899-55374921 AGGCCACAGGCCAGGTATGCTGG - Intergenic
1150118689 17:62579882-62579904 GAGCCACAGGACTTGGGTGCTGG - Intronic
1151351263 17:73533481-73533503 GGGCCTCAGGGCCTGTGTCCAGG - Intronic
1151686066 17:75647338-75647360 GGGACAGAGGACCTGAGTGCAGG - Intronic
1152871263 17:82754321-82754343 GGGCCCCAGGAGCAGTGGGCGGG + Intronic
1154311464 18:13270028-13270050 GTGTCACTGGACCGCTGTGCTGG + Intronic
1155080040 18:22400170-22400192 GGGTCACAGAACCAGTGAGCTGG + Intergenic
1156291519 18:35752164-35752186 GGGCCACAGGACCAGCTTGGTGG + Intergenic
1157473997 18:48009801-48009823 GGGCCCCAGGACCTTTGGGCAGG + Intergenic
1159376198 18:67596745-67596767 GGGCCACAGGACCAGTTGGTGGG + Intergenic
1160949399 19:1658322-1658344 GGGGGACAGGACAGGTGGGCCGG - Intergenic
1161668613 19:5591697-5591719 GGGCCACTGTACTGCTGTGCAGG - Intronic
1162420992 19:10565993-10566015 GGGCCACAGAACCGCCATGCCGG - Exonic
1163059275 19:14746648-14746670 GGGCTTCAGGCCCGGTGTGGTGG - Intronic
1164052804 19:21597566-21597588 GAGCCACATAACCTGTGTGCAGG - Intergenic
1164098025 19:22029329-22029351 GAGCCACAGCACCTGTGTGCTGG + Intergenic
1164117950 19:22240221-22240243 GAGCCACAGCACCTGTGTGCTGG + Intergenic
1164200981 19:23018369-23018391 GAGCCACAGCACCTGTGTGCTGG + Intergenic
1165187638 19:34035749-34035771 GGGCCACAGGACTGGTTGGCTGG + Intergenic
1165937022 19:39395557-39395579 GGGCCACAGGACCGGTGTGCTGG + Intronic
1166001626 19:39880931-39880953 GGGCCCCAGGCCAGGTGTGGTGG + Intronic
1166004408 19:39897182-39897204 GGGCCCCAGGCCAGGTGTGGTGG + Intronic
1167580709 19:50340550-50340572 GAGCCACAGGACTGGTTGGCAGG - Intronic
1168116277 19:54222750-54222772 GGGCCCCAGGACCCGCATGCAGG - Exonic
1168119261 19:54242522-54242544 GGGCCCCAGGACCCACGTGCAGG - Exonic
1168122044 19:54256964-54256986 GGGCCCCAGGACCTGCGTGCAGG - Exonic
1168130093 19:54312338-54312360 GGGCCCCAGGACCCACGTGCAGG - Exonic
1168134117 19:54338869-54338891 GGGCCCCAGGACCCGGGTGCAGG - Exonic
1168151137 19:54449462-54449484 CGGCCCCAGGCCCGGTGCGCAGG - Intronic
1168168992 19:54574086-54574108 GGGCCCCAGGACCCACGTGCAGG + Exonic
1168173678 19:54607880-54607902 GGGCCTCAGGACCTGCGTGCAGG + Intronic
1168185311 19:54696614-54696636 GGGCCCCAGGACCCGCATGCAGG + Intronic
1168282449 19:55312704-55312726 GAGCCGGAGGACCTGTGTGCCGG - Intergenic
925365050 2:3305563-3305585 GGGGCACAGGACAGGAGTGGAGG - Intronic
925836408 2:7951136-7951158 GAGCCACAGGGCCTGTGAGCAGG + Intergenic
926337909 2:11878122-11878144 GGATCACAGGACCAGTGTCCTGG + Intergenic
926752311 2:16207808-16207830 GGGCCACAGGACTGGTTGGCAGG + Intergenic
926889584 2:17627635-17627657 GGGCCACAGAACTGGTTGGCAGG + Intronic
928671454 2:33607374-33607396 GGGCCACAGGAGCAGTGGGCGGG + Intergenic
928671821 2:33610608-33610630 GGGCCACAGAACTGGTTGGCAGG - Intergenic
936257257 2:110927441-110927463 GGAGCACAGGACAGGTGTGGAGG - Intronic
937327556 2:121000464-121000486 GGGACACAGGACCACTGTGATGG - Intergenic
938096589 2:128467883-128467905 GGGCCACAGGACTGGCTTGCAGG - Intergenic
938138397 2:128777303-128777325 GGGGCACAGGATGGGGGTGCAGG + Intergenic
943607059 2:189988109-189988131 GGGCCACAGAACTGGTTGGCAGG + Intronic
944054335 2:195507663-195507685 GGGCCACAGGACTGGTTGTCAGG + Intergenic
948496236 2:238351580-238351602 GGGCCACAGTGAGGGTGTGCTGG + Intronic
1168891984 20:1300698-1300720 CGGCTCCAGGACCGGTGAGCGGG + Exonic
1173632886 20:44529912-44529934 GGGCCACAGAACTGGTTGGCAGG + Intergenic
1175300011 20:57936082-57936104 GGGCCATAGGACCGCTGGGTGGG - Intergenic
1175340913 20:58228527-58228549 GGGACGCAGGAGCGGTGCGCGGG - Exonic
1175892231 20:62321012-62321034 GGGACACAGGACCTGTGGGGAGG + Intronic
1175906554 20:62382747-62382769 GGGCCAGAGGGCAGGTGTGAAGG - Intergenic
1175908673 20:62394324-62394346 GGGCCAGCGGACAGGTGGGCTGG - Intronic
1175977505 20:62718515-62718537 GGGCCACAGGGCTGGAGGGCGGG - Intronic
1176129543 20:63490862-63490884 GGGCCACATGGGCGGAGTGCAGG + Intronic
1179875149 21:44263239-44263261 GAGCCACAGGACAATTGTGCTGG + Intergenic
1179899703 21:44383197-44383219 GGGCCTCAGGAATGGTGTGATGG + Intronic
1182718544 22:32378786-32378808 GGGCCACAGAACCCCAGTGCAGG + Intronic
1184379186 22:44134415-44134437 GGGCCCCAGGAGCCCTGTGCAGG + Intronic
1184730150 22:46367320-46367342 GGGCCAGACCCCCGGTGTGCTGG + Intronic
949360663 3:3228997-3229019 GGGCCACAGGAGCAGTGGGTGGG - Intergenic
950505276 3:13390832-13390854 GGGGCACAGGCCAGCTGTGCCGG - Intronic
954594696 3:51814443-51814465 GGGCCAGTGGAGAGGTGTGCAGG + Intergenic
954753152 3:52824826-52824848 GGGCCACAGGACCTACCTGCTGG + Exonic
957186179 3:76944842-76944864 GGGCCACAGGACCTGCTGGCAGG - Intronic
958930211 3:100199517-100199539 GGGCCACAGGACTGTTTGGCAGG + Intergenic
959811780 3:110628297-110628319 GGGCCACAGGACCAGTTGGTGGG - Intergenic
966162486 3:176983068-176983090 GGGACACAGGACCAGTTGGCAGG + Intergenic
968458369 4:710487-710509 GGCTCACAGCACCGCTGTGCTGG - Intronic
968958477 4:3730701-3730723 GGGCCCCAGGGCGGGGGTGCCGG + Intergenic
968971557 4:3798266-3798288 GGACGGAAGGACCGGTGTGCGGG + Intergenic
969273162 4:6116564-6116586 GGCCAACAGGACTGGTTTGCGGG - Intronic
969583973 4:8081375-8081397 GGGACACAGGACAAGTGAGCAGG - Intronic
970877244 4:20885405-20885427 GGGTCACAGGACTGGTTGGCAGG - Intronic
975865559 4:78720325-78720347 TGGCCACAGGACCAGTTGGCAGG + Intergenic
978382542 4:108144678-108144700 GGGCCACAGGAGGGGTGAACAGG + Intronic
978457379 4:108908901-108908923 GGGCCACAGAACTGGTTGGCAGG + Intronic
980145716 4:128981533-128981555 GGGCCACAGAAACGGTTGGCAGG - Intronic
985622639 5:963487-963509 GAGCCACTGGCCCGGCGTGCAGG - Intergenic
985850772 5:2387664-2387686 GGGCCACAGGGCCAGCCTGCCGG + Intergenic
987079867 5:14417032-14417054 GGAACACAGGACCGGTCTGCAGG - Intronic
988510318 5:31859055-31859077 GGGCCACAGGACCACTTGGCAGG - Intronic
989965839 5:50465199-50465221 GGAGCACAGCACCGGTGGGCTGG - Intergenic
990818899 5:59815391-59815413 GGACCACAGGTACGGTGTGGAGG + Intronic
995037171 5:107547403-107547425 GGACCACAAGACAGGTGTGATGG + Intronic
995320879 5:110832331-110832353 GGGCCACAGGAGCAGAGTCCAGG - Intergenic
997566449 5:134890695-134890717 GGGCCACAGGCCAGGTGTGGTGG - Intronic
999246621 5:150158356-150158378 GGGCCTCAGGACGGCTGGGCTGG - Intergenic
1000043040 5:157499505-157499527 GGACCACAGGACTGCTCTGCTGG - Intronic
1000089875 5:157921030-157921052 GGGCCACAGGAGTGGTTGGCAGG + Intergenic
1003819416 6:9879134-9879156 GGGCCACAGGACTGGTTGGTAGG - Intronic
1004193790 6:13486968-13486990 TGGCTACAGGAGCGGGGTGCAGG - Exonic
1005034766 6:21545417-21545439 GGACCACAGGACTGGTTGGCAGG + Intergenic
1006057572 6:31396640-31396662 GGGCCACAGGACTGGTTGGCAGG + Intergenic
1006070001 6:31491306-31491328 GGGCCACAGGACTGGTTGGCAGG + Intergenic
1006338927 6:33435330-33435352 GGGCCAAAGGACAGGGGTGATGG + Intronic
1010729880 6:79380046-79380068 GGGCCACAGTACCGGGTGGCAGG - Intergenic
1011486012 6:87842154-87842176 GGGCCACAGGACTGGTTGACGGG + Intergenic
1011584391 6:88908943-88908965 GGGCCAGAGGACAAATGTGCAGG + Intronic
1013974715 6:116064118-116064140 ATGTCACAGGACCTGTGTGCAGG - Intergenic
1017692541 6:156981191-156981213 GGTCCACATGACCTGTGGGCAGG + Intronic
1018953088 6:168391635-168391657 TGGGGACAGGACAGGTGTGCTGG - Intergenic
1018953096 6:168391661-168391683 GAGGGACAGGACAGGTGTGCTGG - Intergenic
1018953109 6:168391715-168391737 GAGGGACAGGACAGGTGTGCTGG - Intergenic
1018953122 6:168391769-168391791 GAGGGACAGGACAGGTGTGCTGG - Intergenic
1018953144 6:168391851-168391873 TGGGGACAGGACAGGTGTGCTGG - Intergenic
1018953160 6:168391905-168391927 TGGGGACAGGACAGGTGTGCTGG - Intergenic
1018953175 6:168391959-168391981 GAGGGACAGGACAGGTGTGCTGG - Intergenic
1018953253 6:168392255-168392277 GAGGGACAGGACAGGTGTGCTGG - Intergenic
1018953260 6:168392283-168392305 GAGGGACAGGACAGGTGTGCTGG - Intergenic
1018953290 6:168392393-168392415 TGGGCACAGGACGGGTGTGCTGG - Intergenic
1018953299 6:168392420-168392442 TGGGGACAGGACGGGTGTGCTGG - Intergenic
1018953309 6:168392447-168392469 TGGGGACAGGACGGGTGTGCTGG - Intergenic
1018953319 6:168392474-168392496 TGGGGACAGGACGGGTGTGCTGG - Intergenic
1018953329 6:168392501-168392523 TGGGCACAGGACGGGTGTGCTGG - Intergenic
1018953338 6:168392528-168392550 TGGGCACAGGACGGGTGTGCTGG - Intergenic
1019272394 7:157665-157687 GGTCCACAGGCCCTGAGTGCTGG - Intergenic
1019321012 7:415263-415285 GGGTCACAGGGCCAGTTTGCAGG + Intergenic
1020014137 7:4821110-4821132 GAGGCGCAGGCCCGGTGTGCAGG - Intronic
1020764751 7:12305659-12305681 GGGGCACAGGACTGGTTGGCAGG - Intergenic
1021717016 7:23469836-23469858 GGGCCCCAGGCCCGGCGCGCTGG - Intronic
1023012104 7:35933458-35933480 GGGCCACAGGACTGGTTGGCAGG - Intergenic
1023843583 7:44109373-44109395 GGGCCACAGGATGGGGGTGCTGG + Intronic
1023852004 7:44155682-44155704 GGGCCAAAGGACCAGAGTCCAGG - Intronic
1024079015 7:45840400-45840422 GGGCCACAGGACTGGTTGGCAGG + Intergenic
1025125761 7:56343546-56343568 GGGCCACAGGACTGGTTGGCAGG - Intergenic
1029556381 7:101272721-101272743 GGGCCACAAGACTGGTTGGCAGG - Intergenic
1033067283 7:138168118-138168140 GGGCCACAGGACTGGTTGGCAGG + Intergenic
1034541508 7:151761478-151761500 GGGCCACAGGACTGGTTGGGTGG - Intronic
1035229878 7:157458526-157458548 GGGGCACAGGACGGTTGTGATGG + Intergenic
1038339114 8:26669328-26669350 GGGCCACAGGAGCAGTTGGCAGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038869604 8:31479930-31479952 GGGCCACAGGACTGGTCAGAGGG - Intergenic
1042770427 8:72374787-72374809 GGGCCACAGTACCTATGTGGGGG - Intergenic
1043284394 8:78511618-78511640 GAGCCAGAGGCCCTGTGTGCTGG - Intergenic
1049154102 8:141056481-141056503 GGTCCACAGGACAGGTAGGCAGG + Intergenic
1049676254 8:143890588-143890610 GGAGCACTGGACAGGTGTGCAGG - Intergenic
1051291744 9:15552599-15552621 GAGCCACAGCAACGGTGGGCTGG - Intergenic
1051599031 9:18853470-18853492 GGGCCACAGGACCAGTTAACAGG + Intronic
1051833937 9:21312965-21312987 GAGTCACAGGACCTGTGTGCAGG + Intergenic
1055121244 9:72663260-72663282 GGGCCACAGGACTGGTTGGTGGG + Intronic
1055484643 9:76745494-76745516 GGGCCACAGGAGTGGTTGGCAGG - Intronic
1055703311 9:78970532-78970554 GGGCCACGGGAGCAGTGTGGAGG - Intergenic
1056574890 9:87848496-87848518 GGGCTTCAGGAATGGTGTGCTGG + Intergenic
1059102357 9:111483399-111483421 GGGCGCCAGGCCCGGTGGGCGGG - Intronic
1059244987 9:112842228-112842250 GGGCCACAGGCCTGATGTGGGGG - Intronic
1060665868 9:125431849-125431871 GGGCCACAGGAGCCATGGGCAGG - Intergenic
1061814975 9:133189082-133189104 GGGACACAGGTCAGGTGTGGAGG - Intergenic
1188686366 X:33075195-33075217 GGGCCACAGGAGCAGTTGGCAGG - Intronic
1189194164 X:39138367-39138389 GGGCCACAGGACTGGTTGGCAGG + Intergenic
1189515849 X:41712843-41712865 GGGCCACAGAACTGGTTGGCAGG - Intronic
1189546739 X:42049734-42049756 GGGGCACAGGTCCTGTGTGCAGG - Intergenic
1195042999 X:101031260-101031282 AGGCCTTAGGACCGGTGTGGTGG - Intronic
1198082000 X:133248963-133248985 GGGCCACAGGAGCAGTTGGCAGG - Intergenic
1198698484 X:139369702-139369724 GGGCTACAGGACTGGTTGGCAGG + Intergenic