ID: 1165937421

View in Genome Browser
Species Human (GRCh38)
Location 19:39397807-39397829
Sequence ACCGCAGCGGGAGCCAGCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165937413_1165937421 -1 Left 1165937413 19:39397785-39397807 CCTCCTCTCTTCCTGCCTGAGCA 0: 1
1: 0
2: 4
3: 51
4: 559
Right 1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 172
1165937412_1165937421 13 Left 1165937412 19:39397771-39397793 CCTAAACACAGCAGCCTCCTCTC 0: 1
1: 0
2: 5
3: 40
4: 349
Right 1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 172
1165937414_1165937421 -4 Left 1165937414 19:39397788-39397810 CCTCTCTTCCTGCCTGAGCACCG 0: 1
1: 0
2: 2
3: 39
4: 313
Right 1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 172
1165937411_1165937421 19 Left 1165937411 19:39397765-39397787 CCTGGGCCTAAACACAGCAGCCT 0: 1
1: 0
2: 1
3: 20
4: 167
Right 1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165937421 Original CRISPR ACCGCAGCGGGAGCCAGCAG GGG Exonic
900984792 1:6066917-6066939 ACAGCACCGGGAGCCAGATGGGG - Intronic
901022113 1:6260862-6260884 ACCGCAGCCGGAGCCGGAGGCGG - Exonic
901361383 1:8703493-8703515 CCCGCGGCGGCGGCCAGCAGGGG - Intronic
901811304 1:11768125-11768147 GAGGCAGCGGGAGCCAGCGGCGG + Exonic
903889249 1:26558677-26558699 GCCGTGGCGGGAGCCTGCAGAGG - Intronic
905017940 1:34790542-34790564 AGCACAGAGGGAGCCAGCAAGGG + Intronic
905888163 1:41502814-41502836 GCCTCAGCAGCAGCCAGCAGTGG + Intergenic
914001719 1:143699944-143699966 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914005625 1:143729888-143729910 CCCGCTGCCGGAGCCGGCAGGGG + Intergenic
914098091 1:144561134-144561156 CCCGCTGCCGGAGCCGGCAGGGG + Intergenic
914300891 1:146376481-146376503 CCCGCTGCCGGAGCCGGCAGGGG - Intergenic
914514565 1:148362851-148362873 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
915171597 1:153982028-153982050 ACGGCAGAGGGAGTGAGCAGGGG - Exonic
916115494 1:161481886-161481908 ACCGCACAGGTAGCCAGCACAGG + Intergenic
917267924 1:173241706-173241728 ACAACAGAGTGAGCCAGCAGAGG + Intergenic
917793271 1:178513425-178513447 TCCCCAGAGGGAGGCAGCAGAGG - Intronic
920561982 1:206945403-206945425 ACAGCAGCCCAAGCCAGCAGTGG - Intronic
922756991 1:228102267-228102289 ACCGCAGCAGGGGCTAACAGGGG - Intronic
923539248 1:234876269-234876291 ACCCCAGCGTGCCCCAGCAGAGG - Intergenic
924653133 1:245948703-245948725 GCAGCAGCAGGAGCCAGCAGTGG - Intronic
1062895093 10:1097311-1097333 ACCGCAGCAGGATCCAGGACTGG + Intronic
1070961593 10:80503555-80503577 ACCATTGTGGGAGCCAGCAGTGG + Intronic
1072737944 10:97891750-97891772 ACCGATGGGGGAGCCAGCAATGG - Intronic
1074732598 10:116394164-116394186 CAGGCTGCGGGAGCCAGCAGTGG + Intergenic
1075914491 10:126155768-126155790 ACCTGCGGGGGAGCCAGCAGGGG - Intronic
1076618182 10:131770726-131770748 CCCGGAGGGGAAGCCAGCAGAGG + Intergenic
1078010725 11:7571126-7571148 ATCCCAGCTGGGGCCAGCAGAGG - Intronic
1078743534 11:14090783-14090805 CAGGCTGCGGGAGCCAGCAGTGG - Intronic
1081126803 11:39332608-39332630 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
1081710540 11:45212893-45212915 ATCTCAGCGGGGGCCAGAAGGGG + Intronic
1082106868 11:48229982-48230004 CAGGCTGCGGGAGCCAGCAGGGG + Intergenic
1083255431 11:61492538-61492560 ACAGCAGCAGGAGCCAGGGGTGG - Intergenic
1083478339 11:62928014-62928036 CCCACAGTGGGAGCCAGAAGAGG - Intergenic
1084096638 11:66915660-66915682 CCCGCAGGGGGAGCTACCAGGGG + Intronic
1084936517 11:72589936-72589958 ACACCAGCAGGAGGCAGCAGCGG + Exonic
1085750246 11:79155168-79155190 ACCCTAGCGGGACCCAGAAGAGG + Intronic
1091337210 11:134781433-134781455 ACTGCAGCTGCAGCCAGCTGTGG + Intergenic
1092936116 12:13366192-13366214 GCCTCAGCGGGAGCCCGCGGAGG - Intergenic
1095810650 12:46371407-46371429 ACCGCAGCGCCAGCCCGCCGCGG + Intronic
1096154972 12:49336672-49336694 GCCGCGGCTGGAGCCCGCAGAGG - Exonic
1097015084 12:55980351-55980373 ACAGCAGAGGGAGTGAGCAGGGG - Intronic
1100211750 12:92406090-92406112 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
1100980330 12:100157950-100157972 ACCACAGAGGGAGGCAGCAAAGG + Intergenic
1101415787 12:104507053-104507075 CCAGCACCTGGAGCCAGCAGGGG - Intronic
1102310612 12:111842095-111842117 ACCCCAGCGGAAGGCAGCAAGGG + Intronic
1103981270 12:124738411-124738433 ACAGCAGCGGGAAACAGCCGGGG - Intergenic
1104426426 12:128682054-128682076 ACCTAAGCGGGAGCAATCAGAGG - Intronic
1104741294 12:131176706-131176728 ACTGCAGTGGTAGCTAGCAGTGG - Intergenic
1105605023 13:21920144-21920166 CACACTGCGGGAGCCAGCAGTGG - Intergenic
1106923657 13:34590535-34590557 CCGGCAGGGTGAGCCAGCAGTGG - Intergenic
1110364127 13:74662213-74662235 ACCCCAAGGGGACCCAGCAGAGG - Intergenic
1111841226 13:93453899-93453921 CAGGCTGCGGGAGCCAGCAGTGG - Intronic
1113830111 13:113289019-113289041 TCAGCAGCTGGAGCCAGGAGAGG + Intergenic
1118807629 14:69251579-69251601 GCGGCAGGGGTAGCCAGCAGCGG + Intergenic
1119848067 14:77845789-77845811 ACTGCAGAGGGAGTGAGCAGGGG - Intronic
1122672835 14:103385371-103385393 CCGGCAGCCGGAGGCAGCAGAGG + Intronic
1122939393 14:104974475-104974497 AAAGCAGCAGGAGCCTGCAGAGG - Intronic
1124425411 15:29558664-29558686 ACTGCAGAGGGAGTCAGGAGAGG - Intronic
1124649516 15:31464679-31464701 AGCACAGTGGGAGCCATCAGTGG + Intergenic
1126671720 15:51121367-51121389 ACCTCAGCTTGAGCCAGGAGAGG - Intergenic
1128495445 15:68195896-68195918 ACAGCAGGTGGAGTCAGCAGAGG - Intronic
1130273444 15:82464315-82464337 CCTGCAGCGGGATCCAGCCGTGG - Intergenic
1130465795 15:84191686-84191708 CCTGCAGCGGGATCCAGCCGTGG - Intergenic
1130498470 15:84481850-84481872 CCTGCAGCGGGATCCAGCCGTGG + Intergenic
1130588084 15:85196282-85196304 CCTGCAGCGGGATCCAGCCGTGG - Intergenic
1131282383 15:91032349-91032371 ACCACAGAGGGAGGCAGCAAAGG + Intergenic
1132511144 16:342054-342076 CTGGCTGCGGGAGCCAGCAGTGG + Intronic
1132717878 16:1301198-1301220 ACGGCAGCAGGGGTCAGCAGAGG - Intergenic
1132836687 16:1957750-1957772 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
1132994608 16:2816764-2816786 AGCCCAGCGGGAGCCCGCAGTGG + Intergenic
1135765963 16:25178245-25178267 CGAGCAGCGGCAGCCAGCAGAGG - Intergenic
1138328107 16:56191850-56191872 GCCGCAGCCGGAGCCGACAGAGG - Intronic
1139857089 16:69989979-69990001 ATCCCAGCAGGAGCCAGAAGAGG + Intergenic
1141116186 16:81311889-81311911 ACAGCAGCAGGAGCATGCAGAGG + Intergenic
1145710021 17:26963137-26963159 ACCGCAGTGGGAGAAAGCCGCGG - Intergenic
1147609566 17:41793595-41793617 ACTGCGGCTGGAGCCAGGAGAGG + Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149616741 17:58007192-58007214 ACGGCAGAGCGAGCCCGCAGCGG + Exonic
1150266819 17:63837548-63837570 ACCAAATGGGGAGCCAGCAGGGG + Exonic
1152245584 17:79183142-79183164 AGCGCAGCGGGGGCCACCGGTGG + Intronic
1152464638 17:80458858-80458880 AGCGCACTGGGAGCCAGCAGGGG - Intergenic
1152579696 17:81160462-81160484 CCCGCAGAGGAAGCCGGCAGAGG - Intronic
1153608085 18:6854870-6854892 ACTGGAGTGGGAGCCAGGAGCGG - Intronic
1155241422 18:23867069-23867091 CCCACAGGGGGAGGCAGCAGGGG + Intronic
1155517356 18:26637007-26637029 ACCGCAGCGGGTGAGAGCAGTGG - Intronic
1156149213 18:34223364-34223386 GCCGCAGCGGGAGCCTGCTTTGG + Exonic
1158139552 18:54242093-54242115 ACCGGAGTGGGAGCCAACAGTGG + Intergenic
1160243004 18:77136465-77136487 ACCCCAGAGGGAGCCAGGAAAGG + Intergenic
1160491151 18:79337464-79337486 AAAGCAGCGCGCGCCAGCAGAGG - Intronic
1160577464 18:79864506-79864528 CCCCCAGCGGGAGACAACAGAGG + Intronic
1160623114 18:80184577-80184599 CCCGCAGCGGGAGCGAGGCGCGG + Intronic
1161038125 19:2096606-2096628 GCCTCAGCGGGAGCCGGCCGAGG + Intronic
1163220006 19:15911943-15911965 ACCTCAGCGGGCACCAGCCGCGG - Intergenic
1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG + Exonic
1166369341 19:42292577-42292599 ACCTGACCGGGAGCCAGCAGTGG - Exonic
1167160876 19:47766389-47766411 TGGGGAGCGGGAGCCAGCAGGGG + Intergenic
927139330 2:20118969-20118991 AACACACCAGGAGCCAGCAGGGG + Intergenic
927144678 2:20155086-20155108 AGAGCAGGAGGAGCCAGCAGAGG + Intergenic
927473904 2:23397405-23397427 ACCTCTGGGGGAGGCAGCAGGGG + Intronic
934561260 2:95314723-95314745 TCCCCAGCAGGAGGCAGCAGGGG - Intronic
935175160 2:100642741-100642763 ACCGAAGCAGGGGTCAGCAGGGG - Intergenic
936077240 2:109409386-109409408 AGAGCAGCTGGAGACAGCAGTGG + Intronic
939972426 2:148677999-148678021 CAGGCTGCGGGAGCCAGCAGTGG - Intronic
941844842 2:170122284-170122306 ACTGCAGGGAGAGGCAGCAGAGG + Intergenic
948797677 2:240413076-240413098 GCCTCAGCGGGAGCCAGGTGAGG - Intergenic
948803531 2:240443385-240443407 ACCGCCTCAGGAGACAGCAGTGG - Intronic
1172974272 20:38894645-38894667 ACCTCTGCGAAAGCCAGCAGGGG - Intronic
1173620123 20:44430144-44430166 ACAGCAGAGGGAGGCAGCAGAGG - Exonic
1176024488 20:62978783-62978805 CCCGCAGCCTGAGCCAGCATGGG + Intergenic
1177730820 21:25025087-25025109 CCAGCAGCAGCAGCCAGCAGTGG + Intergenic
1178849354 21:36200344-36200366 ACCGCCGCGTGTGCCAGGAGAGG - Exonic
1180024163 21:45149147-45149169 GCCACATCAGGAGCCAGCAGAGG - Intronic
1180699602 22:17774248-17774270 ACCGCGGTGGGAGCCAGAGGAGG - Intronic
1180754666 22:18152661-18152683 ACCGCAGCTGAAGTTAGCAGGGG - Intronic
1180972484 22:19822683-19822705 ACGGCAGCCACAGCCAGCAGAGG + Intronic
1181004904 22:20008648-20008670 TCCACAGCGGGAGGCAGCTGGGG - Intronic
1181857905 22:25795632-25795654 ACTGCAGCTGGAGCAAACAGAGG - Intronic
1183264774 22:36818423-36818445 GGGGCAGCTGGAGCCAGCAGAGG - Intronic
1183667514 22:39254145-39254167 ACTGCAGCGGGCGCCAGAGGAGG - Intergenic
1184240209 22:43207848-43207870 ACCTCAGCTGAAGCCTGCAGAGG + Intronic
1184817523 22:46883689-46883711 AGGGCAGCGTGGGCCAGCAGGGG - Intronic
1185043142 22:48515867-48515889 ACCCCTGGGGGAGCCAGCAGTGG - Intronic
949478549 3:4471681-4471703 ACCCCAGAGGGAGCTCGCAGAGG - Intergenic
950811229 3:15651630-15651652 GCCGCAGCAGGAGTCAGGAGCGG - Intergenic
955386662 3:58486261-58486283 TGCTCAGCAGGAGCCAGCAGGGG + Intergenic
957419511 3:79950802-79950824 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
961754853 3:129121667-129121689 GCCGGGGCGGGAGCCAGCCGGGG - Exonic
964495628 3:157286876-157286898 AATGCAGCGGGAGCGAGCACAGG + Intronic
966634986 3:182123004-182123026 AGAGCAGTGGGAGTCAGCAGGGG - Intergenic
967308612 3:188084808-188084830 ACTGCAGTAGGAACCAGCAGAGG + Intergenic
972913428 4:43846948-43846970 CACGCTGCAGGAGCCAGCAGTGG + Intergenic
974590454 4:63942433-63942455 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
976387913 4:84481949-84481971 ACCGCAGCGGGAGGGGGCAAGGG + Intergenic
979528356 4:121741176-121741198 ACTGTGGAGGGAGCCAGCAGGGG - Intergenic
982215915 4:153082527-153082549 ACCACAGCAGGAGACAGAAGTGG + Intergenic
983058298 4:163125554-163125576 ACCGCAGAGGGAAACTGCAGTGG + Intronic
983843158 4:172482012-172482034 ACCCCACCGGGAGGCAGCTGAGG + Intronic
984662399 4:182387499-182387521 AAGGCTGCCGGAGCCAGCAGTGG + Intronic
984851521 4:184157299-184157321 GCTGCAGTGGGATCCAGCAGTGG - Intronic
985123763 4:186669907-186669929 ACAGCAGCAGGGGCCAGCAGTGG - Intronic
985658726 5:1145092-1145114 ACAGCAGCTGGAGGCCGCAGGGG + Intergenic
995326273 5:110893457-110893479 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
998157718 5:139795954-139795976 CCCGCGGCGGGGACCAGCAGCGG + Exonic
998406274 5:141876378-141876400 GGCGCAGCGGGCGCCAGGAGGGG + Intronic
999655972 5:153811091-153811113 AGCGGGGCAGGAGCCAGCAGCGG + Exonic
1002439631 5:179257561-179257583 GCATCAGCGGGAGCCAGCAGCGG - Intronic
1002602262 5:180360772-180360794 ACCCCAGGGGGAGCCAGCCCTGG + Intergenic
1002906897 6:1456560-1456582 GAGGCTGCGGGAGCCAGCAGTGG - Intergenic
1002934702 6:1661760-1661782 ACTGCAGCTGGACCCAGCAGTGG - Intronic
1003460060 6:6320754-6320776 TCCACAGCTGGAGCCAGTAGGGG + Exonic
1005712139 6:28512607-28512629 GCGGCTGCCGGAGCCAGCAGTGG + Intronic
1005940300 6:30555665-30555687 GCCGCAGCGGGAGCCGGGAGCGG - Exonic
1006637181 6:35469080-35469102 GGCTCAGCGGGAGCCTGCAGGGG - Intronic
1006829191 6:36958591-36958613 ACTGGGGCGGGAGCCTGCAGAGG + Intronic
1007236065 6:40392202-40392224 GCCGCAGGGGGCCCCAGCAGTGG + Exonic
1008053271 6:46921731-46921753 ATCAGAGCGGGAGCCAGCCGGGG - Exonic
1012111040 6:95234072-95234094 GCCAAAGCGGGAGCCAGCAGTGG - Intergenic
1013709418 6:112879932-112879954 ATCCCAGCGGGTGCCAGGAGAGG + Intergenic
1014460139 6:121686003-121686025 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
1020383124 7:7567230-7567252 GCCTCAGCGGGAGCCACCGGGGG + Intronic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1025838686 7:65123080-65123102 GCCGCAGCGGGAGAAAGCCGCGG - Intergenic
1025884386 7:65572902-65572924 GCCGCAGCGGGAGAAAGCCGCGG + Intergenic
1026975577 7:74495709-74495731 AGCTAAGAGGGAGCCAGCAGCGG + Intronic
1035076427 7:156180665-156180687 CCCGCAGAGGCAGCCTGCAGAGG + Intergenic
1043857314 8:85277119-85277141 CAGGCTGCGGGAGCCAGCAGTGG + Intronic
1047406902 8:124593098-124593120 ACACCAGGGAGAGCCAGCAGAGG + Intronic
1048996781 8:139799527-139799549 ACCCTCGTGGGAGCCAGCAGTGG - Intronic
1049057955 8:140254047-140254069 ACTTCAGCGGGCACCAGCAGTGG - Intronic
1049688548 8:143949013-143949035 GCCGCAGAGAGAGCCAGGAGGGG + Intronic
1049698346 8:143994527-143994549 AGGGCAGCTGGAGCCACCAGTGG - Intronic
1051449271 9:17177863-17177885 ACCGCTGCCTGAGCCAGCAGTGG - Intronic
1053434872 9:38068139-38068161 ACCGCAGCAGCAGCGAGCGGCGG - Exonic
1057758547 9:97854839-97854861 CCCCCAGCGGGCGGCAGCAGTGG + Exonic
1058286689 9:103187671-103187693 CAGGCTGCGGGAGCCAGCAGTGG + Intergenic
1059305523 9:113350326-113350348 ACCGCACCAGAAGCCAGAAGGGG - Intronic
1059325441 9:113501505-113501527 CCAGCAGCGGGAGCCCGCACTGG - Intronic
1059658318 9:116376860-116376882 ACGGCAGCAGGTGACAGCAGAGG + Intronic
1060813765 9:126624315-126624337 CCTCCAGCGGGAGCCTGCAGTGG - Intronic
1061062661 9:128258408-128258430 ACCACAGAGGGAGGCAGCAAAGG + Intronic
1061720282 9:132546982-132547004 AACCCAGGGTGAGCCAGCAGGGG + Intronic
1061838952 9:133346856-133346878 ACCGCAGGGGGTGCCAGGACTGG + Intronic
1187246740 X:17559685-17559707 ACTGCCCAGGGAGCCAGCAGAGG - Intronic
1193708828 X:84856035-84856057 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
1195086443 X:101418318-101418340 GCTTCAGCGGGAGGCAGCAGAGG + Intronic
1197753921 X:129982290-129982312 TCCGGAGAGGGAGGCAGCAGTGG - Intronic
1199356095 X:146866273-146866295 CAGGCTGCGGGAGCCAGCAGTGG - Intergenic
1201885901 Y:18881010-18881032 CAGGCTGCGGGAGCCAGCAGTGG + Intergenic