ID: 1165941356

View in Genome Browser
Species Human (GRCh38)
Location 19:39416264-39416286
Sequence CCATTGGGGCCTCAGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2459
Summary {0: 1, 1: 0, 2: 3, 3: 135, 4: 2320}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165941346_1165941356 -7 Left 1165941346 19:39416248-39416270 CCCCAGCCCCAGCAGACCATTGG 0: 1
1: 0
2: 4
3: 27
4: 325
Right 1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG 0: 1
1: 0
2: 3
3: 135
4: 2320
1165941345_1165941356 -6 Left 1165941345 19:39416247-39416269 CCCCCAGCCCCAGCAGACCATTG 0: 1
1: 0
2: 1
3: 41
4: 465
Right 1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG 0: 1
1: 0
2: 3
3: 135
4: 2320
1165941350_1165941356 -9 Left 1165941350 19:39416250-39416272 CCAGCCCCAGCAGACCATTGGGG 0: 1
1: 0
2: 1
3: 19
4: 160
Right 1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG 0: 1
1: 0
2: 3
3: 135
4: 2320
1165941344_1165941356 21 Left 1165941344 19:39416220-39416242 CCTTAGGAGATGCTGGCAGTCAG 0: 1
1: 0
2: 2
3: 26
4: 188
Right 1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG 0: 1
1: 0
2: 3
3: 135
4: 2320
1165941348_1165941356 -8 Left 1165941348 19:39416249-39416271 CCCAGCCCCAGCAGACCATTGGG 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG 0: 1
1: 0
2: 3
3: 135
4: 2320
1165941343_1165941356 22 Left 1165941343 19:39416219-39416241 CCCTTAGGAGATGCTGGCAGTCA 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG 0: 1
1: 0
2: 3
3: 135
4: 2320
1165941342_1165941356 23 Left 1165941342 19:39416218-39416240 CCCCTTAGGAGATGCTGGCAGTC 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1165941356 19:39416264-39416286 CCATTGGGGCCTCAGCCTCCTGG 0: 1
1: 0
2: 3
3: 135
4: 2320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165941356 Original CRISPR CCATTGGGGCCTCAGCCTCC TGG Intronic
Too many off-targets to display for this crispr