ID: 1165952194

View in Genome Browser
Species Human (GRCh38)
Location 19:39480764-39480786
Sequence CCCCTCCCCCGCGTTTCCAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165952188_1165952194 9 Left 1165952188 19:39480732-39480754 CCTTTGGTCTCTCTCGGGCTTCC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 104
1165952184_1165952194 16 Left 1165952184 19:39480725-39480747 CCCGATGCCTTTGGTCTCTCTCG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 104
1165952181_1165952194 30 Left 1165952181 19:39480711-39480733 CCTGCGGCAATCCGCCCGATGCC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 104
1165952185_1165952194 15 Left 1165952185 19:39480726-39480748 CCGATGCCTTTGGTCTCTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 104
1165952183_1165952194 19 Left 1165952183 19:39480722-39480744 CCGCCCGATGCCTTTGGTCTCTC 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG 0: 1
1: 0
2: 2
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165952194 Original CRISPR CCCCTCCCCCGCGTTTCCAT TGG Exonic
900779340 1:4607532-4607554 GCCCTCCCCATCTTTTCCATGGG - Intergenic
901743209 1:11355796-11355818 CCCCTCCCCCTCTTTGCGATGGG + Intergenic
903812036 1:26039950-26039972 CCCCTCCCACGCCTGCCCATTGG + Intronic
905338602 1:37262647-37262669 CCCCTCCCCCAATTTTCCAGAGG + Intergenic
905626109 1:39491551-39491573 CCCCGCCCCCGCGCCCCCATTGG + Intergenic
907259945 1:53210517-53210539 CCCCGCCCCCGAGTTTCCCCTGG + Exonic
907498753 1:54862762-54862784 CCCCTCCCCCATGTTTCAAATGG + Intronic
917920777 1:179747932-179747954 CCCCTCCTCCCCCTTTCCCTAGG - Intronic
922125027 1:222713157-222713179 CCCTTGCCCCGCATCTCCATTGG + Intronic
922707135 1:227795616-227795638 CCCCACCCCCTCCTTCCCATGGG + Intergenic
924415345 1:243850864-243850886 CCCCTCGCCCGCGTGGCCCTTGG + Intronic
1064180376 10:13109374-13109396 TCCCTTCTCCCCGTTTCCATAGG + Intronic
1069651786 10:70054031-70054053 GTCCTCCCCCGCCTTTCCTTGGG + Intronic
1073465883 10:103694261-103694283 CCCCAACCCCGCCTTTCCAGTGG - Intronic
1075688343 10:124379210-124379232 CCCCTCCCTGGCCTTTCCAAGGG + Intergenic
1076587515 10:131559671-131559693 CCCCTCCACCGCAGCTCCATGGG - Intergenic
1078991166 11:16647924-16647946 CCCCTCCCCCACAATTCCACTGG - Intronic
1079299338 11:19263754-19263776 CCCCTCTCCCCAGTTTACATGGG + Intergenic
1079517024 11:21281319-21281341 CCCTTCCCTCCCGTTTCCACAGG - Intronic
1082077008 11:47981749-47981771 CCCCTTCCTGGCATTTCCATAGG + Intronic
1084169093 11:67391932-67391954 CCCCGCCCCCGCCTCCCCATTGG - Exonic
1092974975 12:13736123-13736145 CCCCCCCCCCGCTTTTCTATGGG - Intronic
1096854001 12:54465612-54465634 CCCCTACCCCCCATTTCCACAGG + Intronic
1102300341 12:111766869-111766891 GCCCGCCCCCGCCTTTCCATTGG + Intronic
1103445195 12:120989882-120989904 ACCCTTCCCTGCGTCTCCATGGG - Intronic
1104417326 12:128606304-128606326 CCCCTCCCCCGTGTGGCCAGGGG + Intronic
1104841293 12:131827343-131827365 CCCCCCCCCCCCGCTTCCCTGGG - Intergenic
1113534056 13:111050252-111050274 CCCCTCCCCTGAGTGTCCTTCGG - Intergenic
1114618264 14:24079961-24079983 CCCCTCCACCCCATTTCCATTGG + Intergenic
1117841999 14:59870252-59870274 CCCCACCCCCGCGTCGCCACGGG - Intronic
1118843356 14:69528449-69528471 CCCCTCCCCCGCCCATCCAGGGG - Exonic
1121560133 14:94868460-94868482 CCTCTCCCACCCGCTTCCATTGG - Intergenic
1124251661 15:28110183-28110205 CCCCTCCACCCACTTTCCATTGG - Intergenic
1127100452 15:55559150-55559172 TCCTTCACCCGCGTTTCGATGGG - Intronic
1127275613 15:57440853-57440875 CCCCTCCCCAGAGTTAACATTGG + Intronic
1129847702 15:78775553-78775575 CCCCACCCCCCCGTTTAGATGGG + Intronic
1130014338 15:80175369-80175391 CCCCTCCCCAGCCTCTCCAGGGG + Intronic
1133002511 16:2858349-2858371 CCCCTCCCCTGCCCTTCCAGAGG - Intergenic
1133020140 16:2963554-2963576 CCCCTGCCCCGCCCTTCCCTGGG - Intergenic
1133241244 16:4415932-4415954 CCCCTCCCTCGGGTTTCCGCCGG - Intronic
1134848743 16:17462743-17462765 CCCCTCCTCCGCTTCTCCCTTGG + Intronic
1137877138 16:52007338-52007360 CCCCTCCCTCTCTATTCCATTGG - Intronic
1141701101 16:85642535-85642557 CCCCTCACCTGTGTCTCCATCGG + Intronic
1143609468 17:8009417-8009439 CCCCTCCCCCTCATTTCCATTGG - Intronic
1148152681 17:45405583-45405605 CCCCTCACCCGTGTGTCCCTGGG + Intronic
1153489029 18:5629599-5629621 CCCCTCCCCCGCGTTTCCCCAGG + Intronic
1153900633 18:9614555-9614577 CCCCTCCCGCGCGCGTCCACCGG - Exonic
1158592763 18:58791475-58791497 CCCCTCCCCCGCAAATTCATAGG + Intergenic
1164575738 19:29404417-29404439 CTCCTCCCCGGCATGTCCATGGG - Intergenic
1164748869 19:30636319-30636341 CCCTTCCCCCACATTGCCATGGG - Intronic
1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG + Exonic
1167631473 19:50628721-50628743 CCTCTCACCCGCTTTGCCATAGG - Intronic
925386088 2:3462806-3462828 CCCCTCCCCCGGGTGCCCCTGGG + Intronic
931366827 2:61626547-61626569 CCCCTCCCCTTGGTTTCCCTTGG + Intergenic
936595502 2:113843646-113843668 CCCCTCCCACAAGTTTCCATAGG + Intergenic
936731572 2:115387228-115387250 CCCCTCACCCCCATCTCCATTGG - Intronic
936915000 2:117631221-117631243 CCCCACCCCCGTGTCTCCACAGG + Intergenic
938465386 2:131521671-131521693 CCCCTCCCCCCAGTGTCCACAGG + Intergenic
943834936 2:192506994-192507016 CCCCTTCTCCGCGTTTCTAGGGG + Intergenic
1172026810 20:31954027-31954049 CCCCTCCCCAACATTTCCAGTGG - Intergenic
1173800296 20:45890908-45890930 CCCCTCCCACCCGCTTCCATCGG - Exonic
1174539466 20:51277568-51277590 CCCCTCCCCTGCTTTAACATAGG + Intergenic
1175267041 20:57709434-57709456 CCCCTCCCCGGAGACTCCATCGG - Intronic
1175911918 20:62409044-62409066 CCCCTCCCCAGGGTGTCGATGGG + Intergenic
1176223031 20:63979063-63979085 ACCCTCCCCCGCTTTTGCAGTGG - Intronic
1176241189 20:64076702-64076724 CCTCTCCCCCACCTTCCCATGGG + Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1181455180 22:23055287-23055309 CTCCTCAGCCGTGTTTCCATAGG + Intergenic
1183927513 22:41216764-41216786 CCCCTCCCCCACATTTAGATTGG + Intronic
1184612896 22:45616579-45616601 CCCCTCCCCCCAGTTTCTGTTGG + Intergenic
952882022 3:37991276-37991298 CCCCTGCCCCTCGTGTCCCTGGG - Intronic
953237669 3:41120403-41120425 ACTCTCCCCCGCCTTTCCCTGGG + Intergenic
959849579 3:111071432-111071454 CCCCTTCCCTGCCTTTCCAATGG - Intronic
961521977 3:127472316-127472338 CCCTACCCCCTCTTTTCCATAGG - Intergenic
962807752 3:138939050-138939072 CCCCTCCCTCGGGATTCCACAGG + Intergenic
971368342 4:25995273-25995295 CTCCTTCCCCTCCTTTCCATAGG + Intergenic
982714216 4:158789869-158789891 CCCCTCCTCCCCTTTTCCCTTGG - Intronic
983687562 4:170429392-170429414 CCCCTCCCCAGCATTACCCTGGG - Intergenic
993725050 5:91357439-91357461 CCTCTCTCCTGCGTTTACATTGG + Intergenic
998130849 5:139650404-139650426 CCCCACCCCCGCATTTTCTTTGG + Intronic
999078083 5:148816401-148816423 CTCCTCCCCAGTGTTTACATGGG + Intergenic
1002896563 6:1383372-1383394 CCCCTCCCCTTCATTTCCGTCGG - Intergenic
1003245030 6:4376191-4376213 CCCTTCCCCCTCACTTCCATCGG - Intergenic
1006078181 6:31547703-31547725 CCCCTCCCCCCAGGTTCCAGAGG + Exonic
1006943061 6:37765666-37765688 CCCCAGCCCCAGGTTTCCATTGG - Intergenic
1008013167 6:46490700-46490722 CCCCTCCCCAGCCTCTGCATTGG + Intronic
1012858885 6:104535079-104535101 CCCCTCCCCCAGGATTCCAGAGG + Intergenic
1013417611 6:109938860-109938882 CCTCTCCACCCCATTTCCATGGG - Intergenic
1014442056 6:121485217-121485239 CCCCACCACCGCTTTTCCCTAGG - Intergenic
1019118572 6:169785228-169785250 CCCCTCCCCCGCTGTTCTTTAGG + Intergenic
1019212061 6:170414632-170414654 CTCCTCCCCTGCGTTTCCTAAGG - Intergenic
1019689136 7:2400223-2400245 CCCCTCCCCAGCAGCTCCATTGG - Intergenic
1019731487 7:2631883-2631905 CCCCGCCCCCGAGCCTCCATTGG - Intergenic
1022359574 7:29645034-29645056 GCCCTCACCTGCGGTTCCATGGG - Intergenic
1026439335 7:70430238-70430260 CCCCTCTCCCACGTTGCCCTTGG - Intronic
1029435660 7:100562693-100562715 CCCCTCCCCTGGGTCTCCACAGG - Intronic
1031871276 7:127091791-127091813 CCCCACCCCCGCGGTCCCACTGG + Intronic
1031886511 7:127251237-127251259 CCGCACCCCCGCGGTTCCCTGGG - Intronic
1032497500 7:132373730-132373752 CTCCACCCCTGCATTTCCATGGG - Intronic
1038402653 8:27297205-27297227 CCCCTCCACCATGTGTCCATAGG - Intronic
1042926511 8:73972972-73972994 CCACCCCCCCGCGTTTCCTATGG + Intronic
1045231344 8:100309941-100309963 ACCCTCCCCCGCGCTTCCTCAGG - Intronic
1049762127 8:144336487-144336509 CTCCTCCCCCGCCTGTCCAGGGG - Intergenic
1057821055 9:98331453-98331475 CACCTCCTCTGCGTTTCCACAGG + Intronic
1062368128 9:136221669-136221691 CCCCTCCGCCTCGCTTCCCTGGG - Intronic
1062467068 9:136686226-136686248 CCCCTTCCCCGTGGTTCCAGGGG - Intronic
1062494232 9:136824129-136824151 CCCCTCCCCCAGGTCTCAATTGG + Intronic
1186882273 X:13878339-13878361 CCCTTCCCCCACCTTCCCATTGG - Intronic
1188874780 X:35416414-35416436 CCCCTCCCCCTCAGTTCCAGTGG - Intergenic
1191748557 X:64516237-64516259 CCCCTCGCCCACTTTTCGATGGG + Intergenic
1196534420 X:116825163-116825185 CCCCTCCCCTCCTCTTCCATTGG - Intergenic
1200047732 X:153411579-153411601 CCCCCCGCCCGCGTTTCCTGGGG + Intergenic