ID: 1165953299

View in Genome Browser
Species Human (GRCh38)
Location 19:39486687-39486709
Sequence GTGTGGGAGTGGGGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 963
Summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 872}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165953286_1165953299 1 Left 1165953286 19:39486663-39486685 CCTTCTTTGTTCCCTGGAATCTG 0: 1
1: 0
2: 1
3: 19
4: 347
Right 1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG 0: 1
1: 0
2: 5
3: 85
4: 872
1165953283_1165953299 15 Left 1165953283 19:39486649-39486671 CCAGACATCTGCACCCTTCTTTG 0: 1
1: 0
2: 1
3: 20
4: 226
Right 1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG 0: 1
1: 0
2: 5
3: 85
4: 872
1165953282_1165953299 21 Left 1165953282 19:39486643-39486665 CCTTGGCCAGACATCTGCACCCT 0: 1
1: 0
2: 3
3: 22
4: 200
Right 1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG 0: 1
1: 0
2: 5
3: 85
4: 872
1165953291_1165953299 -10 Left 1165953291 19:39486674-39486696 CCCTGGAATCTGGGTGTGGGAGT 0: 1
1: 0
2: 4
3: 23
4: 200
Right 1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG 0: 1
1: 0
2: 5
3: 85
4: 872
1165953281_1165953299 28 Left 1165953281 19:39486636-39486658 CCTCTAGCCTTGGCCAGACATCT 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG 0: 1
1: 0
2: 5
3: 85
4: 872
1165953285_1165953299 2 Left 1165953285 19:39486662-39486684 CCCTTCTTTGTTCCCTGGAATCT 0: 1
1: 0
2: 3
3: 35
4: 416
Right 1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG 0: 1
1: 0
2: 5
3: 85
4: 872

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165953299 Original CRISPR GTGTGGGAGTGGGGGGAAAT GGG Intronic
900589394 1:3453064-3453086 GTGTGGGGTTGGGGGTAACTTGG + Intergenic
901442849 1:9290067-9290089 GTGTGGGGGTGGGGTGGAGTTGG + Intergenic
901460843 1:9390722-9390744 GGGTGGGAGTGTGGGGCAGTGGG - Intergenic
902145734 1:14397453-14397475 GTTTGGAAGTGGGGTGAAATGGG - Intergenic
902336690 1:15758526-15758548 GGGTGGGAATGGGGGGGAATGGG - Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902919448 1:19657412-19657434 CTGTGGGAGGGGGAGGAAGTTGG + Exonic
903337760 1:22636450-22636472 GTGTGGGAGTGGGGGCAGTGAGG - Intergenic
903609239 1:24597966-24597988 TGGTGGGGGTGGGGGGAACTTGG + Intronic
903619150 1:24685479-24685501 GTGTGGGAGTGTGGGGACCTTGG - Intergenic
903641669 1:24864350-24864372 GGGTGGGAGTCAGGGGAAACAGG - Intergenic
903907156 1:26695737-26695759 GTGTCGGAGTGAGGGGGACTCGG + Intergenic
904076968 1:27850466-27850488 GGGTGGGATTGGGTGGGAATGGG + Exonic
904301524 1:29557541-29557563 GTGTGGGACTTGGTGGAAGTTGG + Intergenic
904400727 1:30254767-30254789 GTGAGGGAGTGGGTAGACATGGG + Intergenic
904602917 1:31683629-31683651 GTTTGGGAGTGGATGGAAGTAGG + Intronic
904867297 1:33590584-33590606 GTGTGTGTGTGATGGGAAATAGG - Intronic
905135738 1:35798315-35798337 GTCAGGGAGTGGGGGGAAAGGGG - Intergenic
905305596 1:37015697-37015719 GAGCCGGAGTTGGGGGAAATGGG - Intronic
905458723 1:38106745-38106767 GGGTGGGAGAGGGAGGAACTGGG + Intergenic
905866836 1:41381372-41381394 GTGTGGGAGTGGGGAGGGATGGG + Intronic
905933424 1:41805951-41805973 GGGAGGGAGTGGGGGGAATCAGG - Intronic
906077921 1:43065563-43065585 GAGTGGGAGTGAGGGAACATGGG + Intergenic
906514854 1:46432879-46432901 GTGTGTGAGGGGGGTGGAATGGG + Intergenic
906756753 1:48325036-48325058 ATGTGGGATTGGGTGGGAATGGG - Intronic
907038200 1:51235423-51235445 GGTTGGGAGTGGAGGGAAGTGGG + Intergenic
907235937 1:53047733-53047755 CTGAGGCAGTGTGGGGAAATGGG - Intronic
907923286 1:58932774-58932796 ATTTGGGCGTGGAGGGAAATGGG + Intergenic
908261311 1:62341346-62341368 GTGTGGGACTGTGTGAAAATGGG - Intergenic
908526975 1:64997702-64997724 GTGTGGGAGTGTGGGGCTGTCGG + Intergenic
908612552 1:65878727-65878749 GTTGGGGAGTCGGGGGAAAGGGG + Intronic
908730053 1:67216903-67216925 GTTTGGTAGAGGAGGGAAATGGG - Intronic
908953528 1:69592157-69592179 GTGTGTGAGGGAGGGGAAAGAGG - Intronic
910239767 1:85073918-85073940 GTGTGGAGGTGGGGAGAAAGTGG + Intronic
910851957 1:91657299-91657321 GTGTGAGATGGGGTGGAAATAGG - Intergenic
910934852 1:92479335-92479357 GTGTGGGTGCTGGGGGAGATGGG + Intronic
911072175 1:93840967-93840989 TTGGGGGAGTGGGAGGAAAGTGG - Intronic
911450230 1:98053281-98053303 GTGTGGGTGTAGGGGGATTTGGG + Intergenic
911613286 1:99980326-99980348 GCATGAGAGTGTGGGGAAATGGG + Intronic
911995293 1:104758231-104758253 GAGGGGGGGTGGGGGGGAATGGG + Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912148810 1:106830619-106830641 GTGGGGGAGTTGGGAGAAATGGG + Intergenic
912499764 1:110114105-110114127 GTGTGTGAGTGGGAGGGAGTGGG + Intergenic
912633796 1:111271802-111271824 GGGTGGGGGTGGGGGACAATGGG - Intergenic
912634068 1:111274878-111274900 GTTGGGGAGTGGAGGAAAATTGG + Intergenic
912749076 1:112270473-112270495 GGGAGGGAGTGGGCTGAAATGGG + Intergenic
912820020 1:112859643-112859665 GGATGGGAGAAGGGGGAAATTGG - Intergenic
912948039 1:114100915-114100937 ATGTGGGAGTGTATGGAAATAGG - Intronic
913561711 1:120027621-120027643 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914263989 1:146021871-146021893 GTGTGGGAGTTGGGGGAGTGGGG + Intronic
914282299 1:146187023-146187045 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914389158 1:147202972-147202994 GTGTGGGAGTGGGATGAGACAGG - Intronic
914425292 1:147570578-147570600 GAGTGGGAATGGGGGGCAAAGGG - Intronic
914543324 1:148637737-148637759 GTCAGGGGGTGGGGGGAAAGGGG - Intronic
914623297 1:149433275-149433297 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
914731287 1:150372900-150372922 GTGTTGGGGAGGGGTGAAATGGG + Intronic
914880930 1:151546520-151546542 GAGAGAGATTGGGGGGAAATGGG - Intronic
915497253 1:156290897-156290919 GGGTGGGGGTGGGGGAGAATAGG + Intronic
915565648 1:156711236-156711258 GGGTGGGGGTGGGGGGTCATTGG - Intergenic
915778852 1:158522627-158522649 GTGTGGGGTTGGGGGGCAAGGGG + Intergenic
916863863 1:168835505-168835527 GGGTGGGATTGGGAGGTAATAGG + Intergenic
917110177 1:171539543-171539565 GGCTAGGAGTAGGGGGAAATAGG - Intronic
917490263 1:175492717-175492739 GTGTGGGAGTGTGGGGAATGGGG + Intronic
917537508 1:175884981-175885003 GGGTGTCAGTGGGGGGAGATGGG - Intergenic
917558198 1:176114592-176114614 GGGAGGGAGTGGGGGGGAAAGGG + Intronic
918015886 1:180632175-180632197 GAGTGGGAGTGAGGGGGAAACGG + Exonic
918412649 1:184275992-184276014 GGGTGAGGGTGGGGGAAAATGGG + Intergenic
918572228 1:186010209-186010231 GTGTGTGTGTGGGGGTACATGGG + Intronic
918631457 1:186723993-186724015 CTGTTGGAGGGTGGGGAAATAGG - Intergenic
918663076 1:187113777-187113799 TTGGGGACGTGGGGGGAAATGGG - Intergenic
918991081 1:191697436-191697458 GTGTGAGAGTGGAGGAAAACTGG + Intergenic
919075990 1:192813641-192813663 GTGTGGGAGAGGGGGAAGAGTGG - Intergenic
919228925 1:194746813-194746835 GTGGGGGATTTGGGGGAAAGTGG + Intergenic
919302376 1:195787113-195787135 GTTGGGGAGTTGGGGGAAAAGGG - Intergenic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
920118584 1:203638631-203638653 GTCTTGGAGTGGGGAGAACTAGG - Intronic
920285492 1:204875782-204875804 TTGTGGGAGTGGGGAGGAACAGG - Intronic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920397549 1:205658234-205658256 GAGTGGAAGTGGGGGGAACCAGG + Exonic
920879875 1:209869922-209869944 GGGTGGGAGTGGGAGTAAAAGGG - Intergenic
921192103 1:212719604-212719626 GTAGGGGAGGGAGGGGAAATGGG - Intergenic
921441833 1:215196695-215196717 GTGTGGGGGCGGTGGGAGATGGG + Intronic
921748057 1:218760181-218760203 GTGTGGGAGTGAGGGAGAGTTGG - Intergenic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
922169627 1:223143562-223143584 GAGTGGGAGTGGGAGAACATGGG - Intergenic
922319292 1:224471383-224471405 GTGGGGGAGTGGGGAGGAAGAGG - Intronic
922392585 1:225161150-225161172 GTGGGGGAGTGGGAGGAAAGTGG - Intronic
923032690 1:230262711-230262733 GTGTGGGGGTGGGAGGTAAGGGG + Intronic
923920540 1:238559645-238559667 GTGTGGGTGTGGGGATTAATAGG + Intergenic
1062966083 10:1608836-1608858 GTCTGGGAGGGAGGGGAGATGGG + Intronic
1063185726 10:3649536-3649558 GTGTGCGAGTGGGGGGGCAAGGG - Intergenic
1063623314 10:7667512-7667534 CTGGGGAGGTGGGGGGAAATGGG - Intergenic
1063629365 10:7719934-7719956 GGGTGGGAGTGGGGAGACTTGGG + Intronic
1063629376 10:7719969-7719991 GGGTGGGAGTGGGGAGACTTGGG + Intronic
1063629387 10:7720004-7720026 GGGTGGGAGTGGGGAGACTTGGG + Intronic
1063629398 10:7720039-7720061 GGGTGGGAGTGGGGAGACTTGGG + Intronic
1063629409 10:7720074-7720096 GGGTGGGAGTGGGGAGACTTGGG + Intronic
1063629420 10:7720109-7720131 GGGTGGGAGTGGGGAGACTTGGG + Intronic
1064060805 10:12135145-12135167 CTGTGGGGGTAGGGGGAAAGGGG + Intronic
1064479093 10:15721573-15721595 GTTAGGAAGTGGTGGGAAATAGG + Intergenic
1065648929 10:27866844-27866866 GTGTTGGAGTGGGGTCTAATGGG - Intronic
1066373418 10:34836584-34836606 GTGTAGGAGTTGGGAGAAGTAGG - Intergenic
1067100828 10:43333253-43333275 CTGTGGGAGTGGGCAGAGATGGG - Intergenic
1067199376 10:44153470-44153492 GTCTGGGAGTGGGGGGCGAGAGG + Intergenic
1067416276 10:46106008-46106030 GTGGGGGAGTGAGGGTAGATGGG - Intergenic
1068019004 10:51557051-51557073 GTGTGGGATTGGGGGAGAAGCGG - Intronic
1068107098 10:52632110-52632132 GGGTGGGAGTGGGGGCGGATGGG - Intergenic
1068127691 10:52861905-52861927 GTCAGGGGGTGGGGGGCAATGGG - Intergenic
1068384034 10:56299859-56299881 GTGTGGGGGGGGGGTAAAATAGG + Intergenic
1068429869 10:56917542-56917564 GTGTGGCAGTGTGGGGAGGTAGG - Intergenic
1068847222 10:61691638-61691660 GTTGGGGAGTGGGGGGCAAGGGG - Intronic
1069021972 10:63499355-63499377 GTGTGAGACTGTGGAGAAATCGG - Intergenic
1069324275 10:67212276-67212298 GTGGAGGAGTGGGGAGAAAGAGG - Intronic
1069546047 10:69329745-69329767 GGGTGGGAGAGGGGTGGAATTGG + Intronic
1070358063 10:75659631-75659653 GACTGGGAGGTGGGGGAAATGGG + Intronic
1070579321 10:77707846-77707868 GTGGGGGAGTGAGGGGAAGTGGG + Intergenic
1070607005 10:77905800-77905822 GTGGGTGAGGGGAGGGAAATGGG - Intronic
1071541113 10:86485062-86485084 GGGGGTGAGTGGGGGGAGATGGG - Intronic
1072169994 10:92849152-92849174 GCGGGGGAGTAGGGGGAAAGCGG - Intronic
1072900556 10:99403218-99403240 GACTGGGTGGGGGGGGAAATTGG + Intronic
1073290883 10:102412668-102412690 GGGAGGGAGTGGAGGGACATGGG + Intronic
1073420649 10:103421247-103421269 GTACGTGAGTAGGGGGAAATGGG - Intronic
1073966869 10:109000490-109000512 GTTGAGGAGTGGGGGGAAAGGGG - Intergenic
1074045200 10:109831688-109831710 GTGGTGGAGTGGGGGGAAGGGGG + Intergenic
1074595557 10:114862352-114862374 GAGAGGGAGAGGGGGGAAAAAGG - Exonic
1074778845 10:116785869-116785891 GTGAGGGGAGGGGGGGAAATAGG - Intergenic
1075360688 10:121830222-121830244 GTGTGGTAGTGTTGGGAGATGGG + Intronic
1075372518 10:121950010-121950032 GTGAAGTAGTGGGGGGAAAAGGG + Intergenic
1075438007 10:122459610-122459632 GTGGGGGAGGGGTGGAAAATGGG + Intergenic
1076277598 10:129216868-129216890 GTGTCGGAGTGTGGGGAGCTAGG + Intergenic
1077045858 11:544863-544885 TGGTGGGAGTGGGGGGACTTGGG + Intronic
1077340366 11:2023717-2023739 GTGTGCGGGTGTGGGGAGATGGG + Intergenic
1077467072 11:2738521-2738543 GGCTGGGAGTGGGGGGAGGTTGG - Intronic
1077560964 11:3260722-3260744 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077566861 11:3306552-3306574 CTGTGGGAGAGGAGGGTAATTGG + Intergenic
1077609565 11:3636022-3636044 GCCTGGGGGTGGGGGGAAATGGG + Intergenic
1077816446 11:5690440-5690462 GTGAGGGAGAGAGGGGAGATGGG + Intronic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1078276456 11:9852343-9852365 GTGGGGGAGGGGGAGAAAATAGG + Intronic
1078394649 11:10969931-10969953 GTGAGGGAATGGGGACAAATTGG + Intergenic
1078771984 11:14359341-14359363 GTGTGGGAGTGGGTGTCAGTTGG + Intronic
1079082827 11:17425830-17425852 GTCTGGGGGTGGGGGGCAAGGGG - Intronic
1079117853 11:17651930-17651952 GGGTGGGGGTGGGTGGAGATGGG + Intergenic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079885987 11:25989540-25989562 GTTTTGGGGTGGGGGGAAGTGGG + Intergenic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080842008 11:35992691-35992713 GTGGGGGTTTGGGAGGAAATAGG + Intronic
1080848767 11:36049473-36049495 GGTTGGGAGTGGGAGGAGATGGG + Intronic
1080885914 11:36368020-36368042 GAGTGGGAGTGGGTGTAAATAGG + Intronic
1081068600 11:38579965-38579987 GTCTGGGAGTGGGGAGCAAGGGG - Intergenic
1081656664 11:44862007-44862029 GAGTGGAGGTGGGGGGAAAAAGG - Intronic
1081692305 11:45086772-45086794 GGGTGAGGGTGAGGGGAAATGGG - Intergenic
1081771152 11:45651262-45651284 GTGTGGGAGTAGGGGGAGTCAGG - Intronic
1081979680 11:47258433-47258455 GTGTTGGAGTGAGGGGGAAGGGG + Exonic
1082067854 11:47915493-47915515 GACGGGGAGTGGGGGGGAATTGG - Intergenic
1083339347 11:61948878-61948900 GTGTGGGGGTGGGGGACAAGGGG + Intergenic
1083352934 11:62043979-62044001 GTGTGGGGGTTGGGGGGAAGAGG + Intergenic
1083387111 11:62319531-62319553 GGGTGGTGGTGGGAGGAAATGGG - Intergenic
1083477871 11:62925775-62925797 GGGAGGGAGTGGGGGGAGAGAGG - Intergenic
1083841145 11:65304972-65304994 GGGTGGGGGTGGGGGGAGAATGG - Intronic
1083890818 11:65595070-65595092 GTGGGGGAGTGAGGGAAGATAGG - Intronic
1084653724 11:70503430-70503452 GGGAGGGAGTGGGAGGAAAGGGG - Intronic
1084789081 11:71462142-71462164 GACTGGGAGTGGGGGGTGATCGG + Intronic
1084937820 11:72596396-72596418 GTGTGGGGGTGGGAGGAGTTGGG - Intronic
1085134683 11:74075367-74075389 GGGGGGGGGTGGGGGGAAGTAGG + Intronic
1085254415 11:75164349-75164371 AAGTGGGAGTGGGTGGATATGGG - Intronic
1085278543 11:75315320-75315342 ATGTGGGTGTGGGGGTCAATGGG - Intronic
1085452853 11:76646906-76646928 GTGTGGAAGTGGGTGGGCATGGG + Intergenic
1086144088 11:83531986-83532008 GGGTGGGAGGGTGGGGAAATGGG + Intronic
1086970857 11:93079100-93079122 GTGTGTGTGTTGGTGGAAATTGG + Intergenic
1087706430 11:101497849-101497871 GTCAGGGGGTGGGGGGCAATGGG - Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088164261 11:106913556-106913578 GTGTGGCAGTGCTGGGAGATGGG - Intronic
1088405770 11:109476610-109476632 GAGTGTGTGTGGGTGGAAATGGG + Intergenic
1088540662 11:110910493-110910515 GTTTGGGATTAGGGGAAAATAGG - Intergenic
1088645372 11:111912942-111912964 GGGTGGGGGTGGGGGGCAAGGGG - Intronic
1088924969 11:114292797-114292819 ATGATGGAGTGAGGGGAAATGGG + Intronic
1089058936 11:115610237-115610259 CTGTGGGAAGGGGGGGAAAGGGG - Intergenic
1089176642 11:116553313-116553335 GGGAGGGAGTGGTGGGATATTGG - Intergenic
1089328288 11:117672386-117672408 TTTGGGGAGTGGGGGGAAAATGG - Intronic
1089403039 11:118175830-118175852 GTGTGGGAGTAGGTGGGAAGCGG - Intronic
1089563389 11:119357123-119357145 GTGGAGGAGTGGGGGGAGAGTGG + Intronic
1089585905 11:119509347-119509369 GGGTGGGGGTGGGGGGGAAGAGG + Intergenic
1089761545 11:120728893-120728915 GTGGGGAAGTGGGGAGAAAGTGG - Intronic
1089825326 11:121270419-121270441 GTGTGGGACTCAGGGGAAAAGGG - Intergenic
1090248749 11:125236520-125236542 CTGAGAGCGTGGGGGGAAATAGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091090748 11:132769126-132769148 GTGTGGGGGTGTGGGGGTATTGG + Intronic
1202823351 11_KI270721v1_random:78906-78928 GTGTGCGGGTGTGGGGAGATGGG + Intergenic
1091388755 12:112286-112308 GTGGGGAAGTGGGGGGAAGGGGG + Intronic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092140239 12:6178794-6178816 TTGTGAGAGTGGGGGAAAAAAGG - Intergenic
1092316903 12:7426287-7426309 GTCTGGGAATGGGGGGCAAGGGG + Intronic
1092926200 12:13274723-13274745 GTCTGGGAGTGGGGGCACAGTGG - Intergenic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093177695 12:15931677-15931699 GTGTGGCAGTGTTGGGAGATGGG + Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093893479 12:24551179-24551201 GTTTGGGGCTGGGGGGAGATGGG - Intergenic
1094099208 12:26742986-26743008 GGCTGGGAGGAGGGGGAAATTGG + Intronic
1094154478 12:27324112-27324134 ATGGGGGAGTTGGGGGAAACAGG - Exonic
1094215347 12:27935052-27935074 GTGTGGGACAGGTGGGATATAGG + Intergenic
1095433961 12:42167135-42167157 GTTGGGGAGTGGGGGGAAAGGGG + Intronic
1095445595 12:42279029-42279051 GTCTGGGGGTGGGGGGCAAGGGG + Intronic
1096039166 12:48499542-48499564 GAGTGGAAGTGGTGAGAAATGGG - Intergenic
1096188171 12:49597460-49597482 GGGTGGGGGTGGGAGGAAATGGG + Intronic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096359140 12:50968391-50968413 GTGTGTGTGTGGGGGGAGACAGG + Intronic
1096738961 12:53677562-53677584 GGGAAGGAGTGGGGAGAAATAGG + Intergenic
1096794011 12:54062669-54062691 GGGTATGAGTGGGGGGAAAGAGG - Intergenic
1096975947 12:55699345-55699367 ATGAGGGAGTTGGGGGAAAGAGG - Intronic
1096988406 12:55777995-55778017 GTGTGGGTGTGGGGGAAACTGGG + Intronic
1097101293 12:56591381-56591403 GTGAGGGAGTGCGGGGCAATGGG + Exonic
1097768986 12:63558434-63558456 GGGTGGGGGTGGGGGGCAAGGGG - Intergenic
1097889944 12:64767794-64767816 GGGGGGGAGGGGGGGGAGATAGG + Intergenic
1098026837 12:66212877-66212899 GTTGGGGGGTTGGGGGAAATGGG + Intronic
1098072386 12:66689817-66689839 GTCTGGGAGTGGGGGAAATGGGG - Intronic
1098369015 12:69738419-69738441 GTGTGTGTGTGGCGGGAGATGGG - Intergenic
1098644835 12:72885665-72885687 GTCGGGGGGTGGGGGGAAAGGGG + Intergenic
1098706212 12:73692996-73693018 GGGTGGGAGTGGGGAGGAGTTGG + Intergenic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1098786732 12:74767820-74767842 GTCTGGGAGGTGGGAGAAATGGG + Intergenic
1098804920 12:75011281-75011303 GTGTGGGAGTGGCAAGAACTGGG + Intergenic
1098828900 12:75334644-75334666 GTGCGGGGGCGTGGGGAAATCGG + Intronic
1099103319 12:78470494-78470516 GTGTGGGAGTGGGGAGCAGGGGG - Intergenic
1099375887 12:81896100-81896122 GTCTGGGGGATGGGGGAAATGGG - Intergenic
1099809470 12:87562202-87562224 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1100011775 12:89962084-89962106 GGGTGGGATGGGGGGGAAATGGG + Intergenic
1100018789 12:90045092-90045114 TTGTGGGAGTGGGAGGCAATGGG - Intergenic
1100297225 12:93274237-93274259 GTGTCGGGGTGGGGGGAGCTTGG + Intergenic
1100329726 12:93571828-93571850 GCGGGGGGGTGGGGGGAAAAGGG - Exonic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1100872317 12:98923028-98923050 GTGTGGCAGTGTGGGGAGATAGG + Intronic
1101010208 12:100441566-100441588 GAGTGGAAGTGGTGAGAAATGGG + Intergenic
1101033039 12:100678530-100678552 GTGTGGGTGTGGGTGGGAGTGGG - Intergenic
1101116214 12:101533958-101533980 CTGTGGGAGAGAGGAGAAATGGG - Intergenic
1101270423 12:103137873-103137895 GTGTGGGGGTGGGGGCATAAAGG + Intergenic
1101523047 12:105502669-105502691 CCGTGGGAGTGGCAGGAAATGGG + Intergenic
1102446518 12:113007123-113007145 GTGTGCAAGTGAGGGGAAACTGG - Intronic
1102587715 12:113934705-113934727 TTGTGAGAGTGGGGACAAATGGG + Intronic
1102809342 12:115810564-115810586 GGGTGGGAGAGAAGGGAAATGGG + Intergenic
1103200378 12:119083181-119083203 GTGGGTGGTTGGGGGGAAATGGG - Intronic
1103238988 12:119397945-119397967 GTGTGGGAGGGGGAGGAAGGGGG + Intronic
1104040401 12:125126447-125126469 GTGTGTGAGTGTGTGTAAATGGG + Intronic
1104214862 12:126725674-126725696 GTGTGTGTGTGGGGGGGACTGGG + Intergenic
1104281956 12:127386536-127386558 GCGTGGGAGTGGGGGGGGCTGGG + Intergenic
1104322304 12:127763033-127763055 GAGTGGGAGTGGGGGTATTTAGG + Intergenic
1104918345 12:132277996-132278018 GTGTGGGAGTGAGGGGGAGGGGG - Intronic
1105304930 13:19161603-19161625 GTGGGGGAGTAGGGGGGAACAGG + Intergenic
1106006560 13:25775470-25775492 GTGTGGGAGTGAGGGGATAGTGG + Intronic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1106766387 13:32918037-32918059 GTGTGGGGGTGGGAGGTTATGGG + Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1108440339 13:50446755-50446777 GCCAGAGAGTGGGGGGAAATGGG - Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1109592787 13:64508897-64508919 GTCGGGGTGTGGGGGGAAAAAGG - Intergenic
1111924231 13:94445883-94445905 GTGGGGGGGCGGGGTGAAATGGG + Intronic
1112024207 13:95397555-95397577 GTGTGGGGGTGGTGGGCGATTGG + Intergenic
1112080016 13:95959256-95959278 GTTTTGGGGTGGGGGGACATAGG + Intronic
1112117414 13:96371614-96371636 GTCTGGGAGTGGGGGAAATGGGG - Intronic
1112459678 13:99592510-99592532 GTGTGAGACTGAGAGGAAATGGG + Intergenic
1113571048 13:111358293-111358315 GTGTGTGTGTGGTGGGGAATAGG + Intergenic
1113871569 13:113563046-113563068 GTGTGGGAGTGGGGTGTAACTGG - Intergenic
1114595823 14:23910833-23910855 GTGTGGGAGCCTGGGGAGATGGG - Intergenic
1114728396 14:24964114-24964136 GTGTCTGGGTGGGGGGAATTGGG - Intronic
1115604609 14:34988065-34988087 GTATGGGAGTGGGTAGAATTAGG + Intronic
1116180592 14:41527223-41527245 GTCAGGGAGTGGGGGGCAAAGGG + Intergenic
1116499958 14:45608368-45608390 GTGTGGTAGTGGGAGGGAATGGG + Intergenic
1116870546 14:50065712-50065734 GTGTGACTGTGTGGGGAAATGGG - Intergenic
1116870787 14:50067648-50067670 GTGTGACCGTGTGGGGAAATGGG - Intergenic
1117091817 14:52258714-52258736 GAGTGGGGGTGGGGGGCAATTGG + Intergenic
1117101870 14:52356906-52356928 GGGTGGGAGTTGGGGTAAAGAGG + Intergenic
1117258277 14:54002641-54002663 TGGTGGGAGTGGGGACAAATGGG - Intergenic
1117884698 14:60348396-60348418 GCGTGGGAGGGAGGGGAAACAGG - Intergenic
1117940670 14:60960743-60960765 GTGAGTGAGTGGGTGGATATGGG - Intronic
1118048000 14:61993259-61993281 GTGGGGGTGTGGGGGGCAAGGGG + Intergenic
1118366689 14:65102426-65102448 GTGTGTGTGTGGGGGGGACTCGG - Exonic
1118984752 14:70744190-70744212 CTGTGGGAGTGGGGGGCTAGGGG + Intronic
1119317820 14:73710107-73710129 GTGTGGGTGTGAGGAGAAATGGG + Intergenic
1119535025 14:75395939-75395961 GAGGGGGAGTGGGGAGAAAAGGG + Intergenic
1120262549 14:82205149-82205171 GTAGGGGAGTGGGAGGAAGTGGG - Intergenic
1120313832 14:82866260-82866282 GAGTGGGAGAGAGGGGAGATGGG + Intergenic
1120373277 14:83666868-83666890 GTGAGGGAGTGGGGGATAATGGG - Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1120836672 14:89044291-89044313 GGGTGGTGGTGGGGGGAAAGAGG + Intergenic
1120853604 14:89193518-89193540 GTGGGGGGGTGGGGGGTCATAGG - Intronic
1121025916 14:90616110-90616132 GTGGGGAACTGAGGGGAAATTGG + Intronic
1121102353 14:91258624-91258646 GAGTGGGAGTGCAGGGAACTTGG + Intergenic
1121215438 14:92244159-92244181 GTGTTGGAGTGGGGACTAATGGG - Intergenic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121500261 14:94430242-94430264 GTATTGAAGTGGGGGTAAATAGG - Intergenic
1122755506 14:103976031-103976053 GGCTGGGAAGGGGGGGAAATAGG - Intronic
1123490228 15:20774884-20774906 GTGGGGGAGTGGGGGGGGAAGGG - Intergenic
1123546729 15:21343971-21343993 GTGGGGGAGTGGGGGGGGAAGGG - Intergenic
1124071381 15:26396269-26396291 GTGCTGGACTGGAGGGAAATTGG + Intergenic
1124115094 15:26833943-26833965 GAGTGGGAGAGAGGGGAATTTGG - Intronic
1124126174 15:26939618-26939640 GCGAGGGAGTGGGGGGAGAGAGG + Intronic
1124366488 15:29075263-29075285 GTGTGGGGGTGGGGGACCATTGG + Intronic
1124956483 15:34363726-34363748 GTGGGGGTGGGGGTGGAAATGGG - Intronic
1125175075 15:36811636-36811658 GTTGGGGAGTGGGGAGCAATTGG + Intergenic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1125577592 15:40766086-40766108 GTGGGGGAGAGGGGGGATGTTGG - Exonic
1125954519 15:43780565-43780587 GGCTGGGAGGAGGGGGAAATCGG - Intronic
1125983882 15:44030239-44030261 GTGAGGGAAGGAGGGGAAATTGG + Intronic
1126310667 15:47313025-47313047 GTGTGGGGCTGGGGGTACATGGG - Intronic
1126357506 15:47812020-47812042 GTGTGGGGGCGGGGGGTATTAGG - Intergenic
1126628222 15:50706613-50706635 GGGTGGGAGTGGGGGAATGTGGG + Exonic
1126849274 15:52787635-52787657 GTGGGGGAGTGGGGGGGGAGGGG + Intronic
1127069685 15:55276645-55276667 GACTGGGAGGAGGGGGAAATGGG + Intronic
1127577322 15:60304297-60304319 GTGTGTGTGTGTTGGGAAATAGG - Intergenic
1127694255 15:61428995-61429017 TTGGGGGACTTGGGGGAAATCGG - Intergenic
1127855741 15:62952279-62952301 GTGGGGGGGTGGGGGGAAATTGG + Intergenic
1127886949 15:63209895-63209917 GTTGGGGAGTGGGGGGCAAGGGG - Intronic
1128006033 15:64242392-64242414 GACTGGGAGTCGGGGGAAAGTGG - Intronic
1128184613 15:65634031-65634053 GTGAGGGAGAGGGAGGAATTTGG + Intronic
1128421903 15:67499955-67499977 CTGAGGGAGTGGGATGAAATGGG + Intronic
1128472684 15:67968297-67968319 GCGTTGGAGTGGGGAGAAAGGGG + Intergenic
1129235367 15:74220591-74220613 GTGTGCGAGGGAGGGGAAAGGGG + Intergenic
1129273594 15:74432093-74432115 GGGTGGGGGTGGGGGGTCATGGG + Intronic
1129528386 15:76239535-76239557 GGCTGGGAGGTGGGGGAAATGGG - Intronic
1129741758 15:77992809-77992831 GGGGGGGAGTGGGGGGGAGTGGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1130084330 15:80764615-80764637 GTCTGGGTGTGGGTGGAGATGGG + Intergenic
1130209364 15:81909340-81909362 GGGTGGCAGCGGGGGGAAATGGG - Intergenic
1130828844 15:87578923-87578945 ATTTGGAAGTGGGAGGAAATAGG + Intergenic
1131084682 15:89566458-89566480 GAGTAGGAGTTGGGGGAAAGAGG - Intergenic
1131518839 15:93098373-93098395 GTGTGTGAGTGTGGGGAAGGAGG + Intergenic
1131971458 15:97897537-97897559 GTGTGTGAGTGTTGGGAAAAAGG - Intergenic
1132358550 15:101192508-101192530 GTTTGGGAGTGGGGGGAGTTGGG - Intronic
1132469509 16:94148-94170 CTGTGGGAGTCGGGGCACATGGG - Intronic
1132534446 16:471167-471189 GTGTGGGAGTTGGGGGCCCTGGG - Intronic
1132592150 16:730752-730774 GGCTGGGAGTGGGAGGAAGTGGG - Intronic
1132644803 16:993946-993968 GGGTGGGTGTGTGGGTAAATGGG - Intergenic
1133255978 16:4516256-4516278 GTCTGGGGGAGAGGGGAAATGGG + Intronic
1133405215 16:5518859-5518881 GTGTGGGAGTGGGGGTTAGGGGG - Intergenic
1133667774 16:7986424-7986446 GTGAGGGAGTGGGGACAAAAAGG - Intergenic
1134441107 16:14300299-14300321 GTCTCGGGGTGGGGGGGAATGGG + Intergenic
1134630627 16:15753317-15753339 GTGTGAGAGTCGGGGGACTTGGG + Intronic
1135243783 16:20836063-20836085 GGGTGGGTGTGGGGGTAAATGGG - Intronic
1135870304 16:26143607-26143629 TTGTGGGGGTGGGGGGAAAGGGG + Intergenic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136067353 16:27768083-27768105 AGGTGGGGGTGGGGGGGAATGGG + Intronic
1136590159 16:31213836-31213858 AGGTGGGAGTGGGGGGAGAAAGG + Intergenic
1136616597 16:31402090-31402112 GTGGGGGAATGGGGAGGAATCGG - Intronic
1137235662 16:46615335-46615357 ATGTAGGGGTGGGGGGAGATAGG + Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137677338 16:50310215-50310237 GAGAGGGAGTGGGGAGAACTGGG + Intronic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1138265126 16:55655163-55655185 GTGAGGGAATGGGGGGACAGTGG - Intergenic
1138525967 16:57607384-57607406 GTGTGGGGGTGGGGGTGTATAGG + Intergenic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1138605833 16:58088231-58088253 GGGTGGGAGTGGGGTGGAGTAGG + Intergenic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1139222060 16:65193729-65193751 GTCTGGGAGTGAGGGGCAAGGGG - Intergenic
1139456734 16:67085498-67085520 GGGTGGGGGTGGGGGGAGATGGG + Intronic
1139640120 16:68285520-68285542 ATGTGGGAGTAGGGGGACAGTGG - Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140100547 16:71912756-71912778 GTCCGGGAGTAGGGGGAAACAGG - Intronic
1140442278 16:74997618-74997640 GTGGGGGGGTGGGGGGAGATGGG - Intronic
1140602695 16:76497689-76497711 GTTGGGGAGTGGGGGGATAGGGG + Intronic
1140661990 16:77197146-77197168 GGGTGGGAGTTGGGGGGAGTGGG + Intronic
1140831420 16:78755044-78755066 GTCTGGGGGTAGGGGGAAAGGGG + Intronic
1140856229 16:78980155-78980177 GGGTGGGAGTTGGAGGAAAAGGG - Intronic
1141732700 16:85833596-85833618 GAGTGGGAGTGAGGGGAAAGCGG - Intergenic
1141742652 16:85904272-85904294 GTGTGGGAGAGGGGTGAAAGGGG + Intronic
1142495794 17:305679-305701 GTGTGGGCGTGGTGGGAGAGTGG - Intronic
1142915876 17:3137478-3137500 GTGAGGGGGTGGGGGGCTATTGG - Intergenic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143575052 17:7787361-7787383 TTGTTGGAGTGGGTGGAAAAGGG - Intronic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1145411417 17:22669304-22669326 GTGTGTGTGTGGGGGGTAAGTGG + Intergenic
1145851664 17:28104934-28104956 GTGTGGGAGTTTGGGGAAGGTGG - Intronic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146926446 17:36749212-36749234 GGGAGGGAGTGGGGAAAAATGGG - Intergenic
1147114660 17:38289932-38289954 GTGTGGGAGGTGGGGGATGTGGG + Intergenic
1147572865 17:41582229-41582251 GAGTGGGGGTGGGGAGAAAGTGG - Intergenic
1147609734 17:41794314-41794336 GTGTGTGAGCTGGGGGAAAGGGG + Intergenic
1148094695 17:45044247-45044269 GTCTGGGACTGTGGGGACATTGG - Intronic
1148414954 17:47499273-47499295 GTGTGGGAGGTGGGGGATGTGGG - Intergenic
1148472599 17:47904560-47904582 ATGGCGGAGTGGGGGGAGATGGG + Intronic
1149369603 17:55979705-55979727 GGCTGGGAGTGGGGGAAATTGGG - Intergenic
1149634858 17:58158430-58158452 GGGTGGGCGTGGGGAGAGATAGG - Intergenic
1149952590 17:61005942-61005964 GTGGTGGAGTGGGGGGAAGGGGG - Intronic
1150016835 17:61565574-61565596 GTCAGGCAGTGGGGGGAAAGGGG + Intergenic
1150473413 17:65456602-65456624 GTGTGGGAGAGTGGGGGAAGTGG - Intergenic
1150481830 17:65516853-65516875 GTGTGGGAGGAGGGAGAAAATGG + Intergenic
1150541080 17:66099845-66099867 GTATGAGAGTGGGGAGATATGGG - Intronic
1150586619 17:66524103-66524125 GTGTGTGAGTGGGAGGAGATGGG + Intronic
1150646106 17:66978464-66978486 GTGTGGGGGAGGGGTGAAGTGGG - Intronic
1151003913 17:70411956-70411978 GTCAGGGGGTGGGGGGCAATGGG - Intergenic
1151081683 17:71336512-71336534 GAGTGGGTGTGAGGGGAAAGGGG + Intergenic
1151198997 17:72453980-72454002 GTGGGGGGGTGGGGGGCAAGAGG - Intergenic
1151481079 17:74370316-74370338 CTGAGGGAGTGGGGTGACATGGG + Intronic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1152102648 17:78311647-78311669 GTGTGGGAGTGGGGAGGATCGGG - Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152524431 17:80879426-80879448 ATGTGGGAGTGGGAGGAGAAAGG - Intronic
1152624054 17:81380156-81380178 TAGTGGGAGTGGGGGGAGAGCGG - Intergenic
1153753835 18:8260595-8260617 GTGTGGCAGTGTTGGGAGATGGG - Intronic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1154145159 18:11861029-11861051 GTGTGGGAGGATGGGGAGATTGG + Intronic
1154192367 18:12241412-12241434 GTCTGGGAGGAGGGGGAGATGGG - Intergenic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1155255279 18:23991800-23991822 GTGGTGGAGTAGGTGGAAATGGG + Intergenic
1155609433 18:27648283-27648305 GGGTGGGAGTGGGTGGAGAAAGG + Intergenic
1155935703 18:31751429-31751451 TTTTGGGAGTAGGGGAAAATGGG - Intergenic
1156183528 18:34635015-34635037 GGTGGGGAGTGGGGGGATATTGG - Intronic
1156516688 18:37686146-37686168 TGGTGGGGGTGGGGGCAAATGGG + Intergenic
1156877466 18:42032215-42032237 GTGTGGCAGTTGTGAGAAATAGG + Intronic
1156911883 18:42420828-42420850 GTGTGGGGGCTGGGGGAAGTGGG - Intergenic
1156988399 18:43376935-43376957 GGTTGGGAGTGGGGAGGAATGGG - Intergenic
1157727297 18:49974616-49974638 CTGTGGGAGATGGGGGAGATAGG + Intronic
1157734522 18:50035007-50035029 GTGTGGGAGTCTGGGGTGATGGG - Intronic
1157780775 18:50437106-50437128 GTGAGGGAGTGGGGGGCTAAGGG + Intergenic
1157799883 18:50610427-50610449 TTCTGGGAGTGTGGGAAAATGGG + Intronic
1157886558 18:51372828-51372850 GTCTGGGGGTGGGGGGCAAGGGG - Intergenic
1158334726 18:56403407-56403429 GTGGTTGAATGGGGGGAAATTGG - Intergenic
1158811498 18:61042607-61042629 GGCTGGGAGTAGGGGAAAATGGG - Intergenic
1158888302 18:61849473-61849495 GTGTGGCTGTTGGGGGAAAGAGG - Intronic
1159157708 18:64605863-64605885 GTCAGGGGGTGGGGGGAAAGAGG + Intergenic
1159428385 18:68319370-68319392 GTCAGGGAGTGGGGGAAAAGGGG + Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160008730 18:75088213-75088235 GTGTGGGATGGGGGTGAACTGGG - Intergenic
1160749240 19:726226-726248 GTGGGGAAGTGGGGGGACCTGGG + Intronic
1160801862 19:974090-974112 GGTTGGGAGTGGGGGGAGCTGGG - Exonic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1162399941 19:10439540-10439562 GTTTGTGAGTGGGGAGGAATCGG + Intronic
1162439616 19:10684505-10684527 GTTTTGGAGTTGGAGGAAATTGG - Intronic
1162566130 19:11446618-11446640 GTGTGGGGGAGGAGGGGAATAGG - Intronic
1162582659 19:11540144-11540166 GTGGGGGAGGGGGGGGACAGTGG + Intronic
1162927225 19:13936685-13936707 GTGGGGGTGTTGGGGGAATTGGG - Intronic
1163020239 19:14477722-14477744 GGGTGGGAGAGGGGGAAGATTGG - Intergenic
1163618103 19:18341351-18341373 GTTTGGGGGTGGGGGGGAGTCGG - Intronic
1163765147 19:19159635-19159657 ATGTGGGGGTGAGGGGGAATTGG + Intronic
1163919242 19:20273337-20273359 GTGTGGATGTGGGGGTAAACAGG + Intergenic
1164046478 19:21547039-21547061 GTCAGGGTGTGGGGGGCAATGGG - Intronic
1164819457 19:31235342-31235364 GGTTGGGGTTGGGGGGAAATGGG - Intergenic
1165445667 19:35855765-35855787 GTGTGGGGGTGGGGAGAGATTGG + Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166125799 19:40714832-40714854 GGTTGGGAGAGGGGGGAAAGTGG - Intronic
1166216955 19:41342039-41342061 GTGTGGGAGTCAGGGGATAGGGG + Intronic
1166660929 19:44647071-44647093 GTGTGGGGGGAGGGGGAACTGGG - Intronic
1166830830 19:45638828-45638850 GTGTGGGTGAGTGGGGAGATGGG - Exonic
1167036610 19:46998722-46998744 GTGTGGGCGTTGGGGGAAAAGGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1168138240 19:54366109-54366131 GGCTGGGAGGAGGGGGAAATGGG + Intronic
1168148289 19:54431412-54431434 GTGCGGGAGTTGGGGGGAAAGGG - Intronic
1168159706 19:54501952-54501974 GGCTGGGAGGAGGGGGAAATGGG - Intronic
1168342996 19:55636347-55636369 GTGAGGGAGTGGGTGGAAATGGG + Intronic
1168391137 19:56008860-56008882 GGGGTGGAGTTGGGGGAAATAGG + Intronic
1168721543 19:58557446-58557468 GTTTGGGAGTGGGGGCATTTGGG - Intronic
925309619 2:2873291-2873313 GTGTGGGAGTGTGTGGGAGTGGG + Intergenic
925482374 2:4290235-4290257 GTCTGGGGGTGAGGGGCAATGGG + Intergenic
925522630 2:4764696-4764718 GTTGGGGGGTGGGGGGAAAGGGG + Intergenic
926049888 2:9737806-9737828 GAGTGGAAGTGGGGGGCACTAGG - Intergenic
926257615 2:11220792-11220814 GGGTGGGAGTAGGGAGAAATAGG - Intronic
926862087 2:17320515-17320537 GTGGGGGAGTGAGGCTAAATGGG + Intergenic
926881369 2:17548201-17548223 GTGTGGGGGTGGGGGAAATGTGG - Intronic
927299622 2:21496935-21496957 GTTGGGGGGTGGGGGGAAAGGGG - Intergenic
927689235 2:25196001-25196023 GTGTGGTAGTGGTGGGGAATAGG - Intergenic
928126397 2:28619657-28619679 GTATGGGAGTGGGTGGTAATGGG + Intronic
928923676 2:36553958-36553980 GTGTGGGAAGGTGGGGAAGTCGG - Intronic
929209713 2:39342000-39342022 GTGTGGGTGTGGGGTCGAATAGG - Intronic
930606337 2:53497141-53497163 GTGTGGGAGTGGCTGGAGAGGGG - Intergenic
930717739 2:54608577-54608599 GAGGGGGAGTGATGGGAAATAGG + Intronic
930846319 2:55908434-55908456 GGGTGAGAATGGGGGGAGATGGG + Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931930890 2:67132224-67132246 GTTGGGGGGTGGGGGGAAAGGGG - Intergenic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932865507 2:75337145-75337167 GTGTGGGAGTGGGATGTAACTGG + Intergenic
933035127 2:77386783-77386805 GTCGGGGAGTGGGGGGCAAGGGG + Intronic
933135867 2:78734423-78734445 AGCGGGGAGTGGGGGGAAATTGG + Intergenic
933493962 2:83024479-83024501 GTTTGCGTATGGGGGGAAATGGG + Intergenic
934051410 2:88214397-88214419 GGGTAGGAGTGGGGAGAAACAGG + Intergenic
934493920 2:94781392-94781414 GTGTGGGGGTGGGAGAAAAAAGG - Intergenic
934859126 2:97749365-97749387 GTGTGGGAAAGGAGGGAGATGGG + Intergenic
936850196 2:116886834-116886856 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
937150661 2:119683506-119683528 GGGTGGGAGTGGTGAGAAAGTGG - Intronic
937277474 2:120694676-120694698 GTGTGGGCGTGGGGGGATGCTGG - Intergenic
937309547 2:120893687-120893709 GTGGGGGGTTGGGGGGAACTTGG - Intronic
937481689 2:122268203-122268225 GCCTGGGAGGAGGGGGAAATGGG - Intergenic
938207291 2:129434856-129434878 GTGGGGGAGTGGGAGGCAAGGGG - Intergenic
938721260 2:134069181-134069203 GTGTGGGACTGGTTGGAAATTGG - Intergenic
938852814 2:135278933-135278955 GTGTGTGAGAGTGGGGCAATAGG + Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
940056211 2:149514945-149514967 GTGTGGGAGTTTGAGGAAAGAGG + Intergenic
940195281 2:151087778-151087800 TGGTGGGTGTGGGAGGAAATAGG - Intergenic
940555879 2:155227961-155227983 GTTGGGGAGTGGGGGGATAGGGG - Intergenic
940839607 2:158564623-158564645 GTGAGGAACTGGGGGGAAATGGG - Intronic
941111536 2:161423258-161423280 GTGTGGGGGTGGGCGAAAAGTGG + Intronic
941415671 2:165217993-165218015 GTCAGGGAGTGTGGGGAAAGTGG - Intergenic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
941637854 2:167955397-167955419 GTGAGGGGGTGGGAGGAAATGGG + Exonic
941864649 2:170322165-170322187 GGGTGGGAGTGGGGTGAAGGTGG - Intronic
941961755 2:171260881-171260903 GTGGAGGAGTGAGGGGAAAGAGG + Intergenic
942202671 2:173587584-173587606 GTCGGGGGGTGGGGGGAAAGGGG - Intergenic
942243070 2:173981796-173981818 GGGTGGGAGTGGGGGTTGATTGG - Intergenic
942257856 2:174124213-174124235 GTGGGGGAGTTGGGGGTATTGGG - Intronic
942629775 2:177942868-177942890 GGCTGGGAGGAGGGGGAAATAGG - Intronic
942865326 2:180666668-180666690 TGGTGGGAGTGGGGAGAAAAGGG + Intergenic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
944135828 2:196398126-196398148 GTGGGGGAGTTAGGGGAAAATGG + Intronic
944288404 2:197977267-197977289 GTGAGGGGGCGGGGGGAAATGGG - Intronic
944395097 2:199257879-199257901 GTGTTGGGGTGGGGGGTAGTGGG + Intergenic
945225977 2:207530853-207530875 GTGTAGGAGCGGGGGGGAAAGGG - Intronic
945257270 2:207813182-207813204 GGGTGGGGGTGGGGGGAGAAGGG - Intergenic
945315064 2:208361586-208361608 GCTTGGGAGTAGGGGGAAAGAGG - Intronic
945417874 2:209597787-209597809 GGGTGGGAGTGGGGAGAGATGGG - Intronic
945723927 2:213451942-213451964 GGGAGGGAGTGGGGTGAGATGGG - Intronic
945877358 2:215292450-215292472 GTGTGTGTGTTGGGGGAATTTGG - Intergenic
945899710 2:215524148-215524170 GTGTGGCAGTGTTGGGACATGGG + Intergenic
946282013 2:218672430-218672452 GTCTGGGAGTGGCAGGAACTTGG + Intronic
946676130 2:222161920-222161942 GTGGGGGAGTTGGGGGACAGAGG - Intergenic
946815610 2:223575534-223575556 GTTTTGGAGTGGGGTCAAATTGG + Intergenic
947618519 2:231574087-231574109 GTGCGGGGGTGGGGGGACCTGGG - Intergenic
947885839 2:233570305-233570327 GGGTGGGGGTAGGGGGAAGTTGG - Intergenic
947921165 2:233875655-233875677 GTCAGGGGGTGGGGGGAAAGGGG - Intergenic
948939218 2:241187807-241187829 GAGGGGGAGTGGGGAGAAAGAGG + Intergenic
1168909709 20:1438097-1438119 GGGAGGGAGGGAGGGGAAATTGG + Intergenic
1169395013 20:5221399-5221421 GTGGGGGACAGGGGGGATATGGG + Intergenic
1169644053 20:7789568-7789590 GTGTGGGAGTAGGGGGTATATGG + Intergenic
1170253897 20:14318306-14318328 GTGTGGAAGTTGGGGATAATGGG - Intronic
1170521153 20:17186756-17186778 GTGGTGGGGTGGGGGGAAAGGGG + Intergenic
1170696019 20:18659749-18659771 GTCAGGGAGTGGGGGGAAAAGGG + Intronic
1170719200 20:18860326-18860348 GTGGGGGAGTGGGGGGAAAGGGG + Intergenic
1171091712 20:22291433-22291455 GTCAGGGACTGGGGGGAAAGAGG + Intergenic
1171460077 20:25293135-25293157 GTGGGGGAGTGGGGGGGATGGGG + Intronic
1171883682 20:30636171-30636193 GTGGGAGGGTGGGGGGAAGTAGG - Intergenic
1171935571 20:31272235-31272257 GAGTGGGTGTGGGTGGATATTGG - Intergenic
1171948198 20:31397167-31397189 GTTGGGGAGTGGGGGGCAAGGGG - Intergenic
1172089697 20:32421064-32421086 GTTGGGGGGTGGGGGGAAAGGGG + Intronic
1173053482 20:39588524-39588546 GTGGGGGAGTGAGTGGAAAAGGG + Intergenic
1173235409 20:41240637-41240659 GTGAGTGACGGGGGGGAAATAGG - Intronic
1173557906 20:43980382-43980404 GTGGGGCAGAGGGGGGACATGGG + Intronic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1173735748 20:45360162-45360184 GTGAGGGATTAGGGAGAAATGGG - Intergenic
1173861279 20:46285300-46285322 GTGGGGGAGTGGGGGAGACTTGG - Intronic
1174064151 20:47852665-47852687 ATGTCGGCGTTGGGGGAAATAGG + Intergenic
1174112136 20:48204464-48204486 GAGTGGGATTGGGGGGGAACAGG + Intergenic
1175106072 20:56615983-56616005 GAATGGGAGTGTGGGGAAATTGG + Intergenic
1175194568 20:57234068-57234090 GAGTGGGGGTGGGGGGACATGGG - Intronic
1175448906 20:59045692-59045714 GTGTGCAAGTGAGGGGAATTTGG - Intergenic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175508665 20:59506136-59506158 GTGTGGGTTTTGGGGGAACTTGG + Intergenic
1175814399 20:61876054-61876076 GTGTGGGAGTGTGTGGACAGGGG - Intronic
1176263313 20:64194683-64194705 GTGAGTGAGTGAGGAGAAATGGG + Intronic
1176720376 21:10387860-10387882 GTCTGGGGGTTGGGGGAAAGGGG + Intergenic
1177689068 21:24480273-24480295 TTGGGGGTGGGGGGGGAAATAGG - Intergenic
1177779606 21:25607875-25607897 GGGCGGGGGTGGGGGGGAATGGG + Intergenic
1177995732 21:28094867-28094889 GTGGGGGAGTGAGGGGAACCAGG + Intergenic
1178823128 21:35993089-35993111 GTGTGGGAGTTGGGGTATGTGGG - Intronic
1179132270 21:38648709-38648731 GTCTGGGAATGAGGGGGAATCGG - Intronic
1179172267 21:38981688-38981710 GAGTGGGTGCTGGGGGAAATTGG - Intergenic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179881274 21:44294253-44294275 GTGTGGGTGTGGGTGGAGAGTGG - Intronic
1180301573 22:11040613-11040635 GTCTGGGGGTTGGGGGAAAGGGG + Intergenic
1180843152 22:18968544-18968566 GGATGGGCATGGGGGGAAATGGG - Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182388694 22:29970955-29970977 GTCTGGGGGTGGGGGGGAAGAGG - Exonic
1182657677 22:31903351-31903373 GTGTGGAAGGTGGGGGGAATAGG - Intronic
1183505945 22:38208938-38208960 AGGTGGCAGTGGTGGGAAATGGG + Intronic
1183975266 22:41508411-41508433 GAGCGGGAGTGGGTGCAAATGGG - Intronic
1184110539 22:42391355-42391377 GGGTGGGGGTAGGGGGACATGGG + Intronic
1203312815 22_KI270736v1_random:154657-154679 GTACTGGAGTGGAGGGAAATGGG + Intergenic
950008390 3:9705404-9705426 GTGGGGGAGAGGGTGGAAAGGGG - Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950583643 3:13878808-13878830 GTGTGGGGGCGGGGGGATCTGGG - Intronic
950626765 3:14253110-14253132 TTGTGGGACTGGGGAGAAACTGG + Intergenic
950926015 3:16742917-16742939 GGGTGGGAGTTAGGGGAAAGGGG - Intergenic
951071285 3:18331873-18331895 GGGTGACAGTGGGGTGAAATGGG - Intronic
951135047 3:19095697-19095719 GTCAGGGAGTGGGGGGCAAAGGG - Intergenic
951562931 3:23986335-23986357 GTTTGGGAGGAGGGGGAAAGGGG + Intergenic
951717522 3:25664807-25664829 GTGTGTGTGTGTGAGGAAATCGG - Intronic
952088650 3:29857360-29857382 GGGTGGGGGTGGGGGTAGATAGG - Intronic
952089493 3:29867244-29867266 GGGTGGGAATGGGGGAGAATGGG + Intronic
952494533 3:33904276-33904298 GTGTGGTAGTGTTGGGAGATGGG + Intergenic
952728760 3:36617624-36617646 GTGAAGGAGAGGGAGGAAATTGG + Intergenic
953287201 3:41622595-41622617 GTCGGGGAGTGGAGGGAAAGGGG + Intronic
953944835 3:47137556-47137578 GTATGCTAGTGGGAGGAAATGGG - Intronic
953966434 3:47310747-47310769 ATGTGGGAGTGAGGGAAAAGAGG - Intronic
953982067 3:47417995-47418017 GTGCGGGGGTGGGGGGAGAGGGG + Intronic
954283960 3:49604772-49604794 GTGTGGGAGGCCTGGGAAATGGG - Intronic
954686899 3:52375998-52376020 GTGTGGGCCTGGGCGGGAATGGG + Intronic
954939274 3:54356107-54356129 GGGTGGGAGGGCGGGGACATTGG + Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956369185 3:68539669-68539691 GTGTGTGTGTGGGGGGGCATGGG + Intronic
957263478 3:77930097-77930119 ATGGGGGAGGGAGGGGAAATGGG + Intergenic
957768948 3:84662921-84662943 GTCTGGGGGTGGGGGGCAAGGGG - Intergenic
957958804 3:87224248-87224270 GTCAGGGGGTGGGGGGAAAGGGG - Intergenic
959414847 3:106071783-106071805 GGGTGGGAGTGGAGGTAGATTGG + Intergenic
960112249 3:113856454-113856476 GGGTGGCAGTGGGAGGAAAGTGG - Intronic
960393564 3:117108796-117108818 GTTGGGGGGTGGGGGAAAATGGG + Intronic
960786496 3:121378165-121378187 GTCGGGGGGTGGGGGGAAAGGGG + Intronic
960887273 3:122409001-122409023 GTGGGGGAGCGGGGGGAGAAAGG - Intronic
960943696 3:122952016-122952038 GGGAGGGAGTGGGGGGAGAAGGG - Intronic
961112761 3:124298951-124298973 GTGGGAGAGTGGGGAGAAGTGGG + Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
962999936 3:140670644-140670666 GTAGTGGAGTGGGGGGAAATGGG + Intergenic
964625866 3:158759317-158759339 GTGTGGTATTGGGGGAAATTGGG + Intronic
964764765 3:160169318-160169340 GTGTGGGAATGGGGAGGAATAGG - Intergenic
964871288 3:161316205-161316227 TTGGGGGAGTGGGAGGAGATGGG + Intergenic
965194835 3:165580384-165580406 GTCGGGGGGTGGGGGGAAAGGGG + Intergenic
965268480 3:166580950-166580972 TTGTGGGCGTGGATGGAAATAGG + Intergenic
965274298 3:166661218-166661240 GTTGGGGGGGGGGGGGAAATAGG - Intergenic
965459574 3:168945466-168945488 GTATGTGGTTGGGGGGAAATGGG + Intergenic
965491818 3:169346755-169346777 GTGTGTAAGAGTGGGGAAATAGG + Intronic
965800659 3:172490615-172490637 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
966119662 3:176507800-176507822 GTGGGGGAGTGGGGGGCTTTTGG - Intergenic
966224379 3:177582275-177582297 GTGTGTGAGTTGGGGGAACCTGG + Intergenic
966300110 3:178469409-178469431 GTCAGGGAGTTGGGGGAAAGGGG - Intronic
966559813 3:181307742-181307764 GTTGGGGAGTGGGGGGCAAGAGG + Intergenic
966690984 3:182741141-182741163 GTGGGGGAGTTGGGGGAACATGG + Intergenic
967087199 3:186106776-186106798 GTGTGTGAGTCTGGGGAAAAAGG + Intronic
967211339 3:187172912-187172934 TTGGTGGAGTGGGGGGAAAAGGG - Intronic
967821997 3:193847043-193847065 GTGATGGAGTTGGGGGATATTGG - Intergenic
968628565 4:1638720-1638742 GTGTGGGAGCGAGGGGATGTGGG - Intronic
968741618 4:2334346-2334368 TTGTTGGAGTGGGGAGCAATGGG - Intronic
968799429 4:2732595-2732617 CTGGGGGAGTGGGGGGATAGCGG + Intergenic
969067975 4:4505074-4505096 CTGGGGGTGTTGGGGGAAATGGG - Intronic
969077050 4:4588173-4588195 GTTGGGGAGTGGGGGGCATTAGG + Intergenic
969164270 4:5292936-5292958 GTCAGGGAGTAGGGGGCAATGGG - Intronic
969308323 4:6338203-6338225 GTGGGGGAGTGGGTGGAGATGGG - Intronic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969607798 4:8211192-8211214 GGGAGGGAGTGGGGAGAAAAGGG - Intronic
969681434 4:8645467-8645489 GTGTGTGGGTGTGGGGACATGGG + Intergenic
970230402 4:13904151-13904173 GTGTGGGGGTGGGGAGGAAAAGG + Intergenic
970343370 4:15129991-15130013 GTGTTGGAGTGGGGGAAGAGAGG - Intergenic
970707922 4:18827251-18827273 GTCTGGGAGGAGGAGGAAATGGG + Intergenic
971287195 4:25302170-25302192 GGGTGGGATTGGGGGGTAATGGG - Intergenic
971306178 4:25483574-25483596 GTGTTGGAGTGGGGGCGGATTGG - Intergenic
971452152 4:26810239-26810261 CTGGGGGAGTGAGGGGAAATGGG - Intergenic
971454287 4:26829576-26829598 GTGTGAGAGAGGGGAAAAATGGG - Intergenic
971500959 4:27317555-27317577 GTCGGGGGGTGGGGGGAAAGGGG - Intergenic
971769363 4:30876900-30876922 GTCTGGGAGTGGGTAGAAAGGGG - Intronic
971810535 4:31419883-31419905 GGCTAGGAGTGTGGGGAAATAGG - Intergenic
972739602 4:41877812-41877834 GGGTGGGAGTGGGGGCCAAAAGG - Intergenic
972858317 4:43135555-43135577 GTGTTGGAGTGAAGGGACATAGG - Intergenic
972919394 4:43919649-43919671 GTCAGGGAGTGGGGGGCAAGAGG - Intergenic
973367338 4:49218442-49218464 GTGGGAGGGTGGGGGGAAGTAGG - Intergenic
973859499 4:55047263-55047285 GTTTTGGAGTGGGGGGAGAGGGG + Intergenic
974579441 4:63776837-63776859 GTGGGGGAGATGGGGGAGATGGG + Intergenic
974687803 4:65253344-65253366 GGGTGGGAGTGGGGAGATTTTGG - Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975208784 4:71675021-71675043 GTTAGGGAGTGGGGGAAAAGTGG + Intergenic
975792645 4:77971176-77971198 GTCTGGGGGTGGGGGGAAAGGGG + Intergenic
976628849 4:87217337-87217359 TTTTGGGGGTGGGGGGAAATAGG + Intronic
976949226 4:90809144-90809166 GTGTGTGTGTGTGTGGAAATGGG - Intronic
977260537 4:94791836-94791858 ACGTGGGAGTGGGAGGAATTAGG - Intronic
977741326 4:100487069-100487091 ATGTAGGAGTGGGAGGAAAAAGG + Intronic
978692572 4:111532928-111532950 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
978714152 4:111821793-111821815 GTGTGGGAGTGAAAGGAAAAGGG - Intergenic
978838694 4:113184210-113184232 GTGTGGGAGTTTTGGGAAATGGG + Intronic
978899604 4:113931021-113931043 GTGGTGGGGTGGGGGGAAAGGGG + Intronic
978985948 4:115013067-115013089 GGGTGGGGGTAGGGGGAAAGTGG + Intronic
979427839 4:120589897-120589919 GCATGGGAGTGGGGGAAGATGGG + Intergenic
979430901 4:120629164-120629186 AGGTGGGAGGGGGAGGAAATGGG + Intergenic
979689370 4:123544151-123544173 GTATGGGATTTGGGGAAAATGGG + Intergenic
979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG + Intergenic
980219366 4:129895536-129895558 GTCTGGGTGTGAGGAGAAATGGG + Intergenic
980244763 4:130224467-130224489 GTTTGGGAGTGTGGGGTCATTGG + Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
981056115 4:140363146-140363168 CTGTGGGACTTGGGGGACATAGG + Intronic
981113744 4:140965750-140965772 GTGGGGGAGTGGAGAGAAAATGG + Intronic
981361525 4:143851088-143851110 GTGTGGGGGAGGGAGGGAATGGG + Intergenic
981372270 4:143972082-143972104 GTGTGGGGGAGGGAGGGAATGGG + Intergenic
981381348 4:144075281-144075303 GTGTGGGGGAGGGAGGGAATGGG + Intergenic
981486287 4:145290047-145290069 GTTTGGGAGTGGGAGGAGGTTGG - Intergenic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
982945465 4:161616697-161616719 GGGTGGGAGTGGGGTGCAGTGGG + Intronic
983892119 4:173040449-173040471 GGGTGGGAGGGGGGTGAAAATGG + Exonic
984059047 4:174968760-174968782 GTGTGTGTGTGGGCGGAAAGTGG - Intronic
984843003 4:184085541-184085563 GGGTGGTAGTGGGAGGAAATGGG + Intergenic
985344835 4:188993161-188993183 GTGTGGGAGTGGGTGAGGATGGG - Intergenic
985416659 4:189742177-189742199 TTGTGGGAGTGGGTGGCAAATGG + Intergenic
986118873 5:4811526-4811548 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
986778893 5:11046038-11046060 GTGTGGGATGGGGTGGAAACGGG + Intronic
987510855 5:18836392-18836414 GTGGGGGAGAAGGGGGAAAAGGG - Intergenic
987852374 5:23373203-23373225 GTCGGGGAGTGGGGGGCAAGGGG - Intergenic
987977670 5:25035731-25035753 GGGGGTGGGTGGGGGGAAATGGG - Intergenic
988867172 5:35348191-35348213 CTGTTGGAGTGTGGGGAACTAGG - Intergenic
989274080 5:39566554-39566576 GTCGGGGAGTGGGGGGCAAAGGG - Intergenic
989687157 5:44103785-44103807 GTTAGGGGGTGGGGGGAAAGGGG - Intergenic
990149724 5:52802288-52802310 GTGTGGAGGTGGGGAGAAAAGGG - Exonic
990173587 5:53082578-53082600 GTGTGGGACAGGGGGTATATGGG - Intronic
990361249 5:55022308-55022330 GTGTGTGTGGCGGGGGAAATGGG - Intronic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990976665 5:61566743-61566765 GTGGGTGAGTGGGGAGAAGTCGG - Intergenic
991270506 5:64773445-64773467 GAGTAGGAGTAGGGGTAAATAGG + Intronic
991491156 5:67183796-67183818 GTGTGTAAGGGAGGGGAAATTGG + Exonic
991530148 5:67605716-67605738 GGGTGGGAGTGGAGGGACAGAGG - Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992158075 5:73974102-73974124 GGGTGGGAGTGAGGGGATTTTGG + Intergenic
992294070 5:75309600-75309622 TTGTGGGAGTGGGAGGCAAGGGG + Intergenic
992414476 5:76539405-76539427 GTCAGGGAGTAGGGGGAACTTGG - Intronic
992861037 5:80910262-80910284 TTGTGGCAGTTGGGGGTAATTGG + Intergenic
992879428 5:81091412-81091434 GTGTGGGATTGGGGAACAATGGG - Intronic
992976330 5:82124444-82124466 GTTTGGGGGTGGGGGACAATGGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993492553 5:88569779-88569801 GTGTGGGAGTGGCAGGAATGTGG - Intergenic
993748410 5:91631251-91631273 GGGTAGGAGCAGGGGGAAATGGG + Intergenic
993764066 5:91833577-91833599 GTCGGGGTGTGGGGGGAAAGGGG - Intergenic
994041847 5:95267827-95267849 GTGTGTGTGTTGGGGGAGATGGG - Intronic
994222443 5:97211482-97211504 CTGTAGGAGTGGGGGGAATGGGG - Intergenic
994390729 5:99190060-99190082 TAGTGGGGGTGGGGGGAGATAGG - Intergenic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995315501 5:110767291-110767313 GTCTGGGAGTGGGAAGAACTGGG - Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996621298 5:125506935-125506957 GTCTGGGGGTGGAGGGAAAGGGG - Intergenic
996746827 5:126853214-126853236 GTGTGGGAGAGGGAGGAGAGGGG + Intergenic
996800559 5:127398061-127398083 GTCTGGGGGTGGGGGGAAAGGGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997089555 5:130841384-130841406 GTTGGGGAGTGGGGGGCAAGGGG - Intergenic
997833070 5:137169193-137169215 GTGAGGGGTTGGGGGGAAGTGGG + Intronic
997870704 5:137502859-137502881 CTGTGGAAGTGGGGTGAAGTGGG - Intronic
998634431 5:143937217-143937239 GTGGGGGAGTGGGGTGAAATGGG + Intergenic
999667653 5:153930462-153930484 GTGGTGGGGTGGGGAGAAATAGG + Intergenic
999713164 5:154336676-154336698 GGGTGGGACTGGAGGGGAATTGG - Intronic
999756824 5:154670724-154670746 GTGTGGGAGTGGGAAGAGAAAGG - Intergenic
1000291168 5:159872920-159872942 GTTTGGGGGTGGGGGGCAAGGGG - Intergenic
1001213687 5:169835187-169835209 GTATGGGAGGGAGGAGAAATGGG + Intronic
1001454242 5:171848506-171848528 GTGTGGGAGGGGGTGGGATTGGG + Intergenic
1001633564 5:173194243-173194265 GTGAGGGAGTGGAGGGATCTGGG + Intergenic
1001773537 5:174312520-174312542 GAGTGGGTGTGCGGGGAAACCGG - Intergenic
1002633311 5:180594904-180594926 GTGTGGGAGTGAGAGGGTATGGG + Intergenic
1002670409 5:180861596-180861618 GTGGGGGCCTGGCGGGAAATGGG + Intergenic
1003909080 6:10727173-10727195 GTGTTGGAGAGGAGGGAAACAGG - Intronic
1004072592 6:12314520-12314542 GTGTGGGAGGGTGGGGAAGGAGG - Intergenic
1004194463 6:13490679-13490701 GTGTTGGGGTGGGGGGAATGGGG - Intergenic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004393371 6:15227618-15227640 GGGTGGGAGTGGGGGGCGAGGGG + Intergenic
1005083051 6:21976567-21976589 GTCAGGGAGTTGGGGGAAAGGGG + Intergenic
1005160518 6:22856440-22856462 GTGTGCGAGAGAGGGGAAATAGG - Intergenic
1006021843 6:31121962-31121984 GAATGGGAGTGGGAGGAAAGAGG + Intronic
1006084737 6:31587772-31587794 GTGTGGGGGTGGGGGCACAGGGG - Intronic
1006136152 6:31897453-31897475 GTGTGGGAGGTGGGGGGAGTGGG - Intronic
1006295258 6:33167374-33167396 GGGTGGGAGTGAGGGGCCATGGG - Intronic
1006388999 6:33747708-33747730 GAGTGGGACTGGGGAGAGATGGG + Intergenic
1006590787 6:35155213-35155235 GAGTTGGAGAGGAGGGAAATGGG - Intergenic
1006733780 6:36256920-36256942 GAGAGGAAGTGGGGGGATATAGG + Intronic
1007426311 6:41748515-41748537 GGGTGGGAGTTGGGGGAGGTGGG - Intronic
1009025762 6:57998604-57998626 GCAGGTGAGTGGGGGGAAATTGG - Intergenic
1009201323 6:60750073-60750095 GCAGGTGAGTGGGGGGAAATTGG - Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1010378810 6:75204671-75204693 GGGTGGGAGTGGGGGCTAAGTGG + Intronic
1010593509 6:77737285-77737307 GTTTGGGAGAGGGAGGAGATTGG + Intronic
1010763850 6:79756024-79756046 GTGTGTGTGTGTGTGGAAATGGG + Intergenic
1010840462 6:80643752-80643774 GTGTGGGAGTGGGGGAGAGGGGG - Intergenic
1011841073 6:91499574-91499596 GAGTGGGGGTGGGGAGAAAGAGG + Intergenic
1012338558 6:98090339-98090361 GTGTGTGGGTGGGGGAAAGTGGG + Intergenic
1012757196 6:103247279-103247301 GTGTGTGATTGTGGAGAAATTGG + Intergenic
1012896045 6:104950727-104950749 AAGTGGGGGTGGGGGGAAAGGGG - Intergenic
1012938043 6:105388487-105388509 GGGTGGGGGTGGGGAGAAAAGGG + Intronic
1013360075 6:109385687-109385709 GTCTGGGAGTGGGGAGAAAGGGG - Intergenic
1013803999 6:113976637-113976659 CTGTGGGAGTTGGGGGCAAGAGG + Intronic
1014729575 6:125016780-125016802 GTGAGGGGGTGGGGGGCAAGGGG + Intronic
1015025880 6:128532001-128532023 AAGTGGGGGTGGGGGGAAAGTGG - Intergenic
1015177809 6:130329911-130329933 GTTGGGGGGTGGGGGGAAAGGGG + Intronic
1015962176 6:138661271-138661293 GAGTGGGAGGTGGGAGAAATAGG - Intronic
1016212878 6:141561958-141561980 ATGGGGGATGGGGGGGAAATGGG - Intergenic
1016453949 6:144212127-144212149 GTGTGAGAGAGTGGGGAAAAGGG + Intergenic
1016763773 6:147769442-147769464 GTGTGTGTTTGGGAGGAAATGGG - Intergenic
1016929216 6:149386447-149386469 GAGTGAGGGTGGGGGGTAATGGG - Intronic
1017297770 6:152818434-152818456 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1019714013 7:2530103-2530125 GGGTGGGAGTGGGGGCTAAGTGG + Intergenic
1019824207 7:3270074-3270096 GTTTGGGAGTGGGTAGAAAAGGG - Intergenic
1020092941 7:5351477-5351499 GTGCGGGGGTGGGGGGAACTCGG + Intronic
1020603442 7:10305671-10305693 CTTTGGGAGTGAGGAGAAATTGG - Intergenic
1021010168 7:15453060-15453082 GTGAGGGAGGGAGGGGAAATGGG + Intronic
1021632279 7:22659211-22659233 TTGGGGGGGTGGGGGGAAGTGGG - Intergenic
1022776172 7:33529634-33529656 GTGGGGGAGTGGGAGGCAACTGG - Intronic
1022960846 7:35424832-35424854 GGGTGGGAGAAGGGGGAAACAGG + Intergenic
1023743718 7:43303073-43303095 GTGTGGGAGAGGGAGGAAGGTGG - Intronic
1024088861 7:45919633-45919655 GTTGGGGAGTTGGGGGAATTAGG + Intronic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024205681 7:47158227-47158249 GTTTGGGGGTGGGGGGCAAGGGG + Intergenic
1024848174 7:53675950-53675972 GGGCAGGAGTGGGGGGAATTTGG - Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025212057 7:57025463-57025485 GTGTGAGAGCGGTGTGAAATGGG + Intergenic
1025659897 7:63551365-63551387 GTGTGAGAGCGGTGTGAAATGGG - Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1027541782 7:79476253-79476275 GTATAGGAGTGAGGGGAAAAGGG - Intergenic
1027696642 7:81419438-81419460 GGGTGGGATTGGGGAGATATTGG + Intergenic
1027805569 7:82817512-82817534 GTTTGGGAGTGGGTGGGACTGGG - Intronic
1027814637 7:82953253-82953275 TTGTTGGAGTGTGGGGAAAGTGG + Exonic
1028374014 7:90126057-90126079 GGGTGGGGGTGGGGGGCAAGGGG + Intergenic
1028618164 7:92793852-92793874 GTGTGGGGGTTGGGGAAAAGTGG + Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1029852266 7:103475328-103475350 GTGCGGGGGTGGGGGGAGTTGGG - Intronic
1030346364 7:108437274-108437296 GAGTGGGAAGTGGGGGAAATGGG + Intronic
1030662810 7:112239497-112239519 GTCTGGAATTGGGGGGAAAGGGG - Intronic
1030731471 7:112994829-112994851 GTGTGGGAATGGGGAGATATTGG + Intergenic
1030994348 7:116340247-116340269 GTGTGACAATGGGGGGAAAGCGG - Intronic
1031081247 7:117259061-117259083 GGGTGGGAGTGTGGGAAAAGTGG - Intergenic
1031649928 7:124276237-124276259 GTGGTGGAGTGGGAGGACATAGG - Intergenic
1031697623 7:124878018-124878040 GGGTGGCAGTGGTGAGAAATGGG + Intronic
1031710675 7:125042513-125042535 GTTGGGGGGTGGGGGGAAAGGGG + Intergenic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032319482 7:130872961-130872983 GTGTGGGAGATGGCGTAAATGGG - Intergenic
1032446581 7:131989380-131989402 TGCTGGGAGAGGGGGGAAATGGG + Intergenic
1032536777 7:132671133-132671155 GTGTGGGAGGGGCGGGGAAGAGG + Intronic
1032906697 7:136375559-136375581 GAGAGGGAGTGAGGGGACATGGG + Intergenic
1032989935 7:137382481-137382503 GTGTGGAACTTGGGGGAAGTAGG - Intronic
1033342690 7:140504466-140504488 GTGTTGGAGTGGGGGGTACAAGG - Intergenic
1033662332 7:143410716-143410738 GTGTGGGAGTAGAGGGAGAGAGG - Intergenic
1034165082 7:149019325-149019347 GTGTGGCAGTGTTGGGAGATGGG + Intronic
1034295588 7:149969340-149969362 CTGGGGGAGTTGGGGGAAACAGG - Intergenic
1034363243 7:150521253-150521275 GACTGGGTGTTGGGGGAAATGGG - Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034937302 7:155208473-155208495 GTGTATGTGTGGGGGGGAATGGG + Intergenic
1035236446 7:157500654-157500676 GTGTGGGAGCGGGTGGAGAAGGG - Intergenic
1035519901 8:267099-267121 GTGTGGGGATGTGGGGAGATGGG + Intergenic
1035605820 8:929222-929244 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035605871 8:929384-929406 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1037923496 8:22826028-22826050 GTGGGGTGGTGGGGGGACATGGG + Intronic
1037992770 8:23332481-23332503 GTGTATGAGTGGGGGGGTATGGG - Intronic
1038865777 8:31437248-31437270 GTGGGGGGGTGGGGGGCAAAAGG + Intergenic
1038925336 8:32133001-32133023 GAGAGAGAGTGGGGGGAAAGGGG - Intronic
1039385057 8:37128289-37128311 GAGAGTGAGTGGGGGGCAATGGG + Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039548074 8:38423989-38424011 GTCTGGGAGTGAGAGGAAAAAGG + Intronic
1039610644 8:38916396-38916418 GTGGGGGGCTGGGGGGAAATGGG - Intronic
1039615374 8:38951087-38951109 GGGTGGGAGTGGGGGGCAGCTGG + Intronic
1040750118 8:50695188-50695210 GTGTGTGAGTGGGGGGATCTTGG - Intronic
1040898852 8:52396281-52396303 GTGAGGGTGGGGGAGGAAATGGG - Intronic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1041134125 8:54737587-54737609 ATAAGGAAGTGGGGGGAAATTGG + Intergenic
1041538138 8:58951566-58951588 AAATGGGAGTGGGGGAAAATAGG - Intronic
1041671843 8:60499713-60499735 GTGTGGATGTGGGGGTAAACAGG - Intergenic
1041673936 8:60518703-60518725 GTGTGTGTGTGTGTGGAAATTGG + Intronic
1043368589 8:79564210-79564232 GTGAGGGGGTGGGGGGCAAGGGG + Intergenic
1043532967 8:81171181-81171203 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1043991000 8:86754526-86754548 TTGTGGGGGTGGGGGGAAAGGGG - Intergenic
1044309034 8:90671335-90671357 GTGTGTGTGTTGGGGGAAAAGGG + Intronic
1044313223 8:90719342-90719364 GTCAGGGTGTGGGGGGAAAGGGG + Intronic
1044405788 8:91824466-91824488 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
1044961604 8:97536570-97536592 GTTGGGAAGTGGGGGGAAAGTGG + Intergenic
1045343625 8:101275081-101275103 GCGGGGGAGTCGGGGGAGATGGG + Intergenic
1045695191 8:104801365-104801387 GTGTGAGAGTAGGGGTATATGGG - Intronic
1046227812 8:111307968-111307990 GTGTGGCAGTGTTGGGAAGTGGG - Intergenic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046616618 8:116484783-116484805 GTGTGTGAGTGGGAGGACAGGGG - Intergenic
1046770952 8:118115855-118115877 GTCTGGGAGTTTGGGGCAATCGG + Intergenic
1047246096 8:123146323-123146345 TTGGGGGAGTGAGTGGAAATGGG - Intronic
1047447296 8:124930743-124930765 ATTTGGGGGTGGGGGGCAATGGG + Intergenic
1047731284 8:127730853-127730875 GTGTTGGGGTCGGGGGAAACTGG + Intergenic
1047907935 8:129492743-129492765 GTCAGGGGGTGGGGGGAAAGGGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048705402 8:137147837-137147859 ATGTGGGAGTGGGAGGCATTAGG - Intergenic
1048727282 8:137400791-137400813 GTGTGGGTGTGCTGGCAAATTGG - Intergenic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1049272244 8:141702219-141702241 GTGTGTGTGTTGGGGGAGATGGG + Intergenic
1049691263 8:143960758-143960780 GTGTGTGGGTGGGGGGAGACAGG - Intronic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1050058938 9:1685218-1685240 GTGTGGGGGTGGGGAGTAAGCGG + Intergenic
1050230810 9:3524985-3525007 GTGTGGGGGGGGGGAGAAAGAGG + Intronic
1050392202 9:5155765-5155787 GTTTGGGGGTGGGGGGATAGGGG + Intronic
1050963936 9:11772189-11772211 GTAGGGGGGTGGGGGGAAAGGGG + Intergenic
1051451091 9:17198674-17198696 GTTGGGGAGTGGGGGGCAAGGGG - Intronic
1052143496 9:25019733-25019755 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
1052253466 9:26426846-26426868 GTGTGGGAGCGGGGTGAAACCGG + Intergenic
1052661804 9:31442426-31442448 GTGGGGGAGTGGTAGAAAATGGG + Intergenic
1052809999 9:33049757-33049779 GTGTGTGTGTGTGTGGAAATGGG - Intronic
1052816691 9:33107421-33107443 GTGTGGGGGTGGGGGGAGAGGGG - Intronic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1053223033 9:36327259-36327281 GGGTGGGAGTCGGGGGTAAAGGG + Intergenic
1053437482 9:38086064-38086086 GTGTGGGAGTATGGGGAATGAGG - Intergenic
1053471277 9:38347443-38347465 GGGTGGGAGGAGGGGGAAAGGGG - Intergenic
1053635184 9:39990965-39990987 GTTGGGGCGTGGGGGGAAAGGGG + Intergenic
1053770748 9:41473346-41473368 GTTGGGGCGTGGGGGGAAAGGGG - Intergenic
1054208703 9:62259733-62259755 GTTGGGGCGTGGGGGGAAAGGGG - Intergenic
1054316101 9:63588407-63588429 GTTGGGGCGTGGGGGGAAAGGGG + Intergenic
1054549479 9:66385170-66385192 GTTGGGGCGTGGGGGGAAAGGGG - Intergenic
1054880191 9:70136518-70136540 GTGTGGGAGGGGGTGGAAGGTGG - Intronic
1054971591 9:71094087-71094109 GGGTGGGGGTGGGGGGCAAGGGG + Intronic
1056180535 9:84078202-84078224 GTGAGGGATTGGGGGCAAGTGGG + Intergenic
1056581916 9:87894774-87894796 CACCGGGAGTGGGGGGAAATTGG + Intergenic
1056604864 9:88077545-88077567 GGGTGGGAGTAGGTGGACATGGG - Intergenic
1056825035 9:89871142-89871164 GTTTGGGTGTTGGGGAAAATGGG + Intergenic
1056935571 9:90912951-90912973 GTGTGGAAGTGGGGGGTGTTGGG + Intergenic
1057115854 9:92520946-92520968 GGCTGGGAGTGGGGAGAAATGGG + Intronic
1057970053 9:99546207-99546229 GTGGAGGAGTGGGGGGAAAGTGG - Intergenic
1058249645 9:102675360-102675382 ATATGGGAGGGGTGGGAAATTGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058726390 9:107808601-107808623 GTCGGGGAGTTGGGGGAAAGGGG + Intergenic
1058944199 9:109841616-109841638 GTGGGGGGGTGGAGGGAAAGAGG + Intronic
1059054596 9:110966121-110966143 GTCTGGGAGTGGGGGAAAAGGGG + Intronic
1059406272 9:114099694-114099716 GGGTGGGAGTGGGGGGTATGTGG - Intergenic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060358183 9:122930698-122930720 GTGTGGGAAGAGGAGGAAATGGG - Intronic
1060426825 9:123513209-123513231 GTGTGGGTGTGGGGTGAACAAGG - Intronic
1060692085 9:125671858-125671880 TTGTGGGGGAGTGGGGAAATGGG - Intronic
1060746581 9:126138035-126138057 GGTTGGGAGAAGGGGGAAATGGG + Intergenic
1060816342 9:126637470-126637492 GTGTGGGGGTGGGGGGTTGTGGG + Intronic
1060947719 9:127579852-127579874 GTGGGGGAGTGTGGGGCAAGGGG + Intergenic
1061180478 9:129022475-129022497 GTGGGGGAGTGGTGGGGAAAGGG + Intronic
1061371539 9:130200509-130200531 GTGGGGGGGTGGGGGGAGCTAGG - Intronic
1061739716 9:132692456-132692478 GGGTGGGAGTGAGGGGAAACAGG - Exonic
1062619178 9:137411741-137411763 GTGGGGGAGTGGGAGGGAGTCGG + Intronic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1186014889 X:5180258-5180280 GTGTGAGAGAGAGAGGAAATAGG - Intergenic
1187429628 X:19210359-19210381 GAGTCAGAGTGAGGGGAAATTGG + Intergenic
1187473186 X:19587327-19587349 GGCTGGGAGAGGGGGTAAATGGG + Intronic
1187843930 X:23516617-23516639 GTGGGGGGCTGGGAGGAAATGGG - Intergenic
1187900896 X:24025709-24025731 GTGTGGGAACGGGGGGGAAGGGG + Intronic
1188036216 X:25320048-25320070 GTCAGGGAGTGGGGGGACAGCGG - Intergenic
1188197454 X:27254859-27254881 GTGTGGGACTGGGGAGATGTTGG - Intergenic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188766992 X:34105819-34105841 GTGGGGTACTGGGGGAAAATGGG - Intergenic
1188803449 X:34559514-34559536 GTGGAGAAGTGGGGGGAAGTGGG - Intergenic
1188818753 X:34747649-34747671 GGTTGGGAGTGAGGGGAATTGGG + Intergenic
1188924369 X:36021662-36021684 GTCGGGGGGTGGGGGGAAAGGGG - Intergenic
1189060297 X:37746544-37746566 TTGTGGGTGTGGGTGGACATGGG - Intronic
1189396239 X:40625210-40625232 GCGGGGGAGTGGGGGGTAAGGGG + Intergenic
1189808825 X:44762291-44762313 GAATGGGAGTGGGAAGAAATAGG - Intergenic
1190021504 X:46882425-46882447 GTGTGGCAGTGTTGGGAGATGGG + Intergenic
1190399391 X:50016725-50016747 GTGGGGGAGGGGGGATAAATAGG - Intronic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191061844 X:56306574-56306596 GTCGGGGAGTGGGGGGCAAGGGG - Intergenic
1191664457 X:63684969-63684991 GTGAGGGGGTGGGAGAAAATGGG + Intronic
1191927061 X:66324746-66324768 GTGTGGGTGTGGGTGGAGATGGG + Intergenic
1192261659 X:69509252-69509274 GGGTGGGGGTTGGAGGAAATAGG - Intronic
1192302759 X:69923284-69923306 GTTTGGGGGTGGGGGGCAAGGGG - Intronic
1192395497 X:70776763-70776785 GGGTGGGAGAGGGGAGAAAAGGG + Intronic
1192430481 X:71108186-71108208 GTGTGGGGGTGGGGGCAGAGAGG - Intronic
1192723384 X:73723807-73723829 GTCAGGGGGTGGGGGGCAATGGG + Intergenic
1193096557 X:77555701-77555723 GTCAGGGGGTGGGGGGAAAGGGG + Intronic
1193674122 X:84426641-84426663 GTGGGGGATATGGGGGAAATGGG + Intronic
1194142716 X:90224201-90224223 GGTTGGGAGGTGGGGGAAATGGG + Intergenic
1194212084 X:91082087-91082109 TTGGGGGAGTGGGGGGATGTGGG + Intergenic
1194256424 X:91641086-91641108 GTGGGTGAGTGGGGGTAAAGAGG - Intergenic
1194891837 X:99388635-99388657 GTGGGGGACTGGGAGGAAAGTGG - Intergenic
1195025470 X:100872758-100872780 GTGTGTAGGTGGGGGGAATTGGG - Intronic
1195101352 X:101557195-101557217 GTGGGGGACTGAGGGGAAGTGGG - Intergenic
1195112153 X:101659267-101659289 ATTTGGGAGTGCTGGGAAATGGG - Intronic
1195344341 X:103934485-103934507 GTCTGGGAGCGGGGGGCAAGGGG - Intronic
1195594602 X:106673675-106673697 GTGTGTGTGTGGGGGGGGATGGG - Intronic
1195982729 X:110597347-110597369 GGGAGGGAGTGGGAGGAAATTGG - Intergenic
1196192029 X:112804892-112804914 GGGTGGGAGGGCTGGGAAATCGG - Intronic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196387860 X:115177788-115177810 GTGGGGGTGTGGGGGGCAAGGGG - Intronic
1196462393 X:115944095-115944117 GTGTAGGGGAGAGGGGAAATGGG - Intergenic
1196532109 X:116799978-116800000 GTGGGGGTTTGGGAGGAAATGGG - Intergenic
1196708424 X:118737802-118737824 GTGTGGGAGTGGGAGGTAGGTGG + Intronic
1197075160 X:122344321-122344343 GTCAGGGGTTGGGGGGAAATGGG + Intergenic
1197466819 X:126814933-126814955 GTGTGTGTGTGTGGTGAAATGGG - Intergenic
1197564623 X:128066930-128066952 GGGTGGGAGTGGGGGAAGGTGGG + Intergenic
1197618034 X:128715946-128715968 GTCGGGGGGTGGGGGGAAAGGGG + Intergenic
1197913136 X:131507159-131507181 TTGTGGGATTGGGGGGCAAGGGG + Intergenic
1197999037 X:132412705-132412727 GTGTGTAAGTGGGGTGGAATAGG - Intronic
1198024595 X:132692890-132692912 GTAAAGGAGTTGGGGGAAATAGG - Intronic
1198445354 X:136708209-136708231 GTCGGGGAGTGGGGTGAAAGGGG + Intronic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1199149861 X:144418402-144418424 GTTGGGGAGTGGGGGGATAGGGG + Intergenic
1200488473 Y:3793304-3793326 GGTTGGGAGGTGGGGGAAATGGG + Intergenic
1200575149 Y:4880368-4880390 GTGGGTGAGTGGGGGTAAAGAGG - Intergenic
1201596589 Y:15677111-15677133 GTCTAGGGGTGGGGGGTAATGGG + Intergenic