ID: 1165955313

View in Genome Browser
Species Human (GRCh38)
Location 19:39498860-39498882
Sequence GGCCCCAAGGGACCAAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 222}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165955313_1165955326 0 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955326 19:39498883-39498905 GGGTAGCTGCCTGAAGGGGCGGG 0: 1
1: 0
2: 4
3: 24
4: 215
1165955313_1165955329 21 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955329 19:39498904-39498926 GGGCCATTCTCTCAGATATAAGG 0: 1
1: 0
2: 1
3: 5
4: 99
1165955313_1165955325 -1 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955325 19:39498882-39498904 CGGGTAGCTGCCTGAAGGGGCGG 0: 1
1: 0
2: 1
3: 12
4: 131
1165955313_1165955323 -4 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955323 19:39498879-39498901 GGCCGGGTAGCTGCCTGAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 98
1165955313_1165955321 -6 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955321 19:39498877-39498899 GGGGCCGGGTAGCTGCCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 193
1165955313_1165955322 -5 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955322 19:39498878-39498900 GGGCCGGGTAGCTGCCTGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 89
1165955313_1165955327 1 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955327 19:39498884-39498906 GGTAGCTGCCTGAAGGGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 157
1165955313_1165955331 26 Left 1165955313 19:39498860-39498882 CCCGCCCTTGGTCCCTTGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 222
Right 1165955331 19:39498909-39498931 ATTCTCTCAGATATAAGGCTTGG 0: 1
1: 0
2: 0
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165955313 Original CRISPR GGCCCCAAGGGACCAAGGGC GGG (reversed) Intergenic
900140198 1:1136653-1136675 GGCCCGCAGGGACCCAGGGCAGG - Intergenic
900301305 1:1978849-1978871 GGCCACATGGGACCCACGGCAGG - Intronic
900368068 1:2319564-2319586 GGCTCCCAGGGACCAGAGGCTGG + Intergenic
900405032 1:2489180-2489202 GGCCCCAAGGCAGAAAGAGCAGG - Intronic
900512330 1:3066620-3066642 AGCCCCTAGGGAAGAAGGGCAGG - Intergenic
901005716 1:6170686-6170708 GGCCCCAAGCAGCCAGGGGCAGG + Intronic
901639556 1:10686470-10686492 TTGCCCAGGGGACCAAGGGCTGG + Intronic
901756736 1:11445980-11446002 TGCCTCATGGGACCAAGGGCAGG - Intergenic
901884706 1:12214915-12214937 GGACACAGGGGACCAAGGGATGG + Intergenic
903012653 1:20342521-20342543 GGCCCCAGGGCAGGAAGGGCTGG - Exonic
903225679 1:21893178-21893200 GACCCACAGGGACCCAGGGCTGG - Intronic
903502737 1:23810561-23810583 GGCCTCTAGGGAGCAAGTGCAGG + Intronic
905345138 1:37306137-37306159 GGAGCCAGGAGACCAAGGGCCGG + Intergenic
905455070 1:38083119-38083141 ACCCCCAAGGGTCCAAGGGCTGG - Intergenic
906142382 1:43541340-43541362 GGGCCCAAGGGACCATGTGATGG - Intronic
907248032 1:53120470-53120492 AGCCCCAGGGGACGCAGGGCAGG - Intronic
908780455 1:67685659-67685681 AGTCCCGAGGGAGCAAGGGCGGG - Intronic
911176235 1:94820596-94820618 GGCCCCAAGGTACTAAGCGGGGG - Intronic
915308557 1:154995038-154995060 TGCCCCAAGTGACAAAGGGCTGG - Intergenic
918195099 1:182213733-182213755 TGCCCTAAGGGAGAAAGGGCAGG + Intergenic
920179432 1:204123296-204123318 GGACCCAACAGACCAAGGGAGGG - Intronic
922067520 1:222158513-222158535 TCTCCCAAGGGACCAAGGGAAGG + Intergenic
922765262 1:228153061-228153083 GGCCCCCAGGGAGCCAGGCCCGG - Intronic
923012039 1:230095767-230095789 GGCCCCAGGGGACCCAGGTGGGG - Intronic
1065709729 10:28504212-28504234 GGCCCCAAGAAACCACTGGCAGG + Intergenic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1070795037 10:79211388-79211410 GGTCCCAAGGGACCTAGGTGGGG + Intronic
1070842848 10:79499866-79499888 GGCCACAAGGGGCCTGGGGCTGG + Intergenic
1071972814 10:90925237-90925259 GGCCTAAATGGACAAAGGGCTGG - Intergenic
1073192265 10:101660066-101660088 GGCCCAAAGGAAGGAAGGGCGGG + Intronic
1073218326 10:101849309-101849331 GGCTCCAAGTGCCCAAGGGTGGG + Intronic
1073381051 10:103078339-103078361 GGCCCCATGGGCCCAGGGACAGG - Exonic
1075021087 10:118952967-118952989 GGGGCCAAGAGAGCAAGGGCTGG - Intergenic
1075091093 10:119444537-119444559 GGCCCCAAGGGGGCATGGGCTGG - Intronic
1075265812 10:120999039-120999061 GGTCCCAAAGGACCCAGGGAGGG + Intergenic
1076871539 10:133197322-133197344 GGCCCCCAGGGACCCAGATCAGG + Intronic
1077136435 11:1001719-1001741 GGCAGGAAGGGACCAGGGGCTGG + Intronic
1079175338 11:18135073-18135095 GGACTCCAGGGACCAGGGGCTGG + Intronic
1079266363 11:18936871-18936893 GGGCTCCAGGGACCAGGGGCTGG - Intronic
1079268506 11:18959102-18959124 GGGCTCCAGGGACCAGGGGCGGG - Intergenic
1083174930 11:60943657-60943679 GGCCCCCAGAGAAAAAGGGCAGG + Intronic
1083328342 11:61885141-61885163 GGCTTCCAGGGACCAAGGCCAGG - Intronic
1083659839 11:64246881-64246903 GGCCGCGGGGGACAAAGGGCGGG - Exonic
1084455351 11:69265059-69265081 GGCCCCAAGGCACCCAGTGCCGG - Intergenic
1084640671 11:70423987-70424009 GGCGCCAAGGGACGCAGGGGAGG + Intronic
1084889527 11:72229904-72229926 GGCCTGGAGGGAACAAGGGCAGG - Exonic
1089189211 11:116641949-116641971 TGCCCCAAAGGGCCCAGGGCTGG + Intergenic
1090226622 11:125075790-125075812 GGCTCCAAGAGCCCAAGGGCAGG - Intronic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1094432158 12:30380915-30380937 CGCCCCATGGGACTGAGGGCTGG + Intergenic
1098145238 12:67490510-67490532 GAATCCATGGGACCAAGGGCTGG + Intergenic
1101707898 12:107237637-107237659 AGCACCAAGGGCCCAAGGTCAGG - Intergenic
1101871085 12:108566117-108566139 TGCCCCAAGGGACCAGGTTCAGG + Intronic
1101927309 12:108983479-108983501 GGGCCCAGGGGGCCAAGGGGTGG - Intronic
1102001737 12:109561679-109561701 GGCCCCCAGGGACCCACGGGTGG - Intronic
1102597582 12:114004686-114004708 GACCAGAAGGGACCAAGGGGAGG - Intergenic
1103292724 12:119860270-119860292 TTCCCCAAGGGACCAAGGGAAGG - Intronic
1103327462 12:120131017-120131039 GGCCCAAAGGGATCAAGTGCTGG + Intronic
1104858146 12:131911453-131911475 AGCCCCAAGTGCCCCAGGGCAGG - Intronic
1107815816 13:44243452-44243474 GGCCCCAAGTGACCAACGGTGGG - Intergenic
1109233698 13:59790090-59790112 AGTCCCATGGGAACAAGGGCTGG - Intronic
1112301964 13:98239200-98239222 AGCCCCAAGGGAACAAGTGCCGG + Intronic
1113807441 13:113118032-113118054 GGCCTCATGGGACCACCGGCTGG + Intronic
1114670598 14:24408854-24408876 GGCCACAATGGCCCAAAGGCTGG - Exonic
1115643426 14:35350200-35350222 GGCCCCAAGGAAACACGTGCTGG - Intergenic
1117162369 14:53002064-53002086 GGCCCAAAGGGACAAGGGCCGGG + Intergenic
1122795269 14:104202988-104203010 GGCACAAAGGGGCCAAGGGTGGG - Intergenic
1122836888 14:104434906-104434928 GGCCCCCAGGGTGCAAGGGAGGG + Intergenic
1122992011 14:105240956-105240978 GGCCCCACGAGACCACGGGCAGG + Intronic
1123067878 14:105627378-105627400 GGCCCCAGCGGACCCTGGGCAGG - Intergenic
1123097328 14:105772720-105772742 GGCCCCAGCGGACCCTGGGCAGG - Intergenic
1123759788 15:23423354-23423376 AGCCCCAGGACACCAAGGGCAGG + Intergenic
1124641942 15:31401355-31401377 AGGCCCAAGGGACCCTGGGCAGG - Intronic
1129267996 15:74404266-74404288 TGTCTCTAGGGACCAAGGGCTGG + Intergenic
1131256945 15:90869281-90869303 GGCCCCTAGGGCCCCAGGTCAGG + Intronic
1131979336 15:97979959-97979981 GGCTGCCAGGGACCAAGGCCTGG + Intergenic
1132458816 16:39263-39285 GGCCCAGAGTGACCATGGGCTGG - Intergenic
1132536717 16:485268-485290 GGACCCAACAGACCAGGGGCAGG - Intronic
1132553829 16:564239-564261 CACCCCCAGGGACCCAGGGCAGG + Exonic
1132981234 16:2739602-2739624 GGCCCCTCAGGACCAAGTGCTGG + Intergenic
1133784597 16:8964119-8964141 GGCCCCCAGGGCCCGGGGGCAGG - Intronic
1134456552 16:14399541-14399563 AGCCCCAGGACACCAAGGGCAGG - Intergenic
1136245801 16:28975138-28975160 GGCCCCCCGGGACCATGGCCGGG + Exonic
1136990165 16:35147169-35147191 GGCCCCAGGGGATCAGGGTCTGG - Intergenic
1137578111 16:49617238-49617260 GGCCCCAAGGATCCAAGGCCAGG + Intronic
1137675495 16:50301902-50301924 GACCCTGGGGGACCAAGGGCTGG + Intronic
1138392285 16:56678861-56678883 GGCCTGAAGTAACCAAGGGCTGG - Intronic
1138580748 16:57939257-57939279 GGCCCCAAGACACCAAGGATGGG + Intronic
1139422408 16:66856792-66856814 GGCCTCAAGGGACCCAGGACTGG + Intronic
1141639784 16:85334421-85334443 GGCCAGAAGGGCCCAAGTGCGGG - Intergenic
1143163866 17:4887837-4887859 GGCCCTAATGGACCCGGGGCAGG - Intronic
1143515549 17:7417701-7417723 GGCCCGAAGGGATGAAGGGAGGG - Exonic
1143845057 17:9767625-9767647 GGCTCCAAGGGGCAAAGGGCAGG + Intergenic
1144646315 17:16976378-16976400 GGCCTCAAGGGACCAGGAGTAGG - Intergenic
1145283858 17:21489168-21489190 TTCCACAAGGGACCCAGGGCAGG - Intergenic
1145393588 17:22476328-22476350 TTCCACAAGGGACCCAGGGCAGG + Intergenic
1146795755 17:35779367-35779389 GGCCCTTGGGGACCAAGGGAGGG - Intronic
1147423233 17:40332704-40332726 GGCCCCAGGGCATAAAGGGCGGG - Intronic
1148115376 17:45172053-45172075 GGCACCGAGGGACCCAGGCCTGG - Intergenic
1148262332 17:46193962-46193984 GGCTGCTAGGGACAAAGGGCGGG - Intronic
1148562547 17:48614223-48614245 GGCCGGAAGGGCCCAAGGCCTGG - Intronic
1148747528 17:49927043-49927065 GGACCCTGGGGACCAAGGCCTGG - Intergenic
1151206691 17:72513150-72513172 GGCCCCAAGAGACTCTGGGCAGG + Intergenic
1151455334 17:74222400-74222422 GGCACTCAGGGCCCAAGGGCAGG + Intronic
1151743686 17:76000700-76000722 GGCACCAGGGGCCCAGGGGCTGG + Intronic
1151803351 17:76390646-76390668 GGCAGCAAGGGAGCAAGTGCCGG + Exonic
1152218252 17:79046907-79046929 GGGCCCACAGGACCAAGAGCAGG + Intronic
1152583510 17:81179266-81179288 GACCCCAGGGGACCCAGGGGAGG + Intergenic
1155556867 18:27029441-27029463 GGAACCAAGGAACCAAGGGTGGG + Intronic
1156507355 18:37606442-37606464 GGCTGGAAGGGACCAAGGTCAGG - Intergenic
1157696676 18:49728752-49728774 GCCCCCTAGGGCCCAAAGGCTGG + Intergenic
1158135139 18:54199645-54199667 TGCCCCAAGTGACCAAAGCCAGG + Intronic
1161307062 19:3574057-3574079 GGGCCCACAGGACCAAGGGGAGG - Intronic
1161568389 19:5016368-5016390 GGCCCCACAGGACCAGGGACCGG + Intronic
1161575798 19:5053599-5053621 GGCTCCCAGGGACCATGGGCTGG - Intronic
1161775733 19:6261132-6261154 GGCCCCATAGGCCCAAAGGCAGG + Intronic
1162931305 19:13959249-13959271 GGGCCAAAGAGGCCAAGGGCGGG + Exonic
1164540781 19:29120121-29120143 GGCCCCCATGCACCAGGGGCTGG + Intergenic
1164735564 19:30538611-30538633 GTCCTCAGGGGACCAAGGGGAGG + Intronic
1165453939 19:35900189-35900211 GGCCCCGAGGGTGCAAGGGCTGG - Intronic
1165493792 19:36140578-36140600 GGCCTAAAGGGCCCCAGGGCGGG - Intronic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
1166377202 19:42334226-42334248 GGCCCCAGGGGAAACAGGGCTGG - Intronic
1166382191 19:42360958-42360980 GGCCCCATGGCACCAGGTGCAGG - Exonic
1166551436 19:43668602-43668624 GACCTCAAGGGGCCAAGGGGCGG - Intronic
1166966358 19:46531507-46531529 GGCCCCAAGGGAAGCAGGGTGGG + Intronic
1168072216 19:53959575-53959597 GGCCCCAAGGGAGTGAGGGTCGG - Intergenic
925006488 2:447135-447157 GGTCACAAGGGACCAAGGGAGGG - Intergenic
927201384 2:20580092-20580114 AGCCCCAAGGGGGCAAGGACTGG + Intronic
927514383 2:23663327-23663349 GGACCCAAGGGCTCTAGGGCTGG - Intronic
929533721 2:42767753-42767775 GGCCCCAAGGCCCCAAGAGTGGG + Intronic
930008302 2:46915469-46915491 GGCCCCTAGGGACCAGGGAAGGG + Intronic
934978375 2:98822031-98822053 GGCCCCCAGCGACCAAGGAAAGG - Exonic
935631753 2:105217860-105217882 GGCCCGAAGGGATAATGGGCAGG + Intergenic
936089140 2:109489649-109489671 GGCCCCGAGGCCCCCAGGGCAGG - Intronic
937910290 2:127072311-127072333 GGCCCCTAGGGCACCAGGGCAGG - Intronic
938063808 2:128270485-128270507 GGCCTCAAGGGCCAGAGGGCGGG + Intronic
938231871 2:129668678-129668700 TACCACAAGGGACCAAGAGCAGG + Intergenic
940456775 2:153911811-153911833 GGCACCAAGAGACAAAGGACAGG - Intronic
945241523 2:207681360-207681382 GGCCGCGGGGGACAAAGGGCGGG + Intergenic
948479926 2:238242886-238242908 TGGCCCAAGGGACAAATGGCAGG - Intergenic
948547530 2:238743359-238743381 GGCCCCAAGAGAGCAAGCGCTGG - Intergenic
1169131706 20:3169189-3169211 GGACCCAAGGCACAAAGGGAAGG - Intronic
1169211148 20:3767003-3767025 GGCCCCAAGGGTCCAGGTGTAGG + Intronic
1171042845 20:21781666-21781688 GGCACAAGGGGACCTAGGGCTGG - Intergenic
1171371467 20:24665081-24665103 GGCCCCAAGGGAATAAGAGAAGG - Intronic
1172795150 20:37531950-37531972 GGGCCCCAGGGAGAAAGGGCTGG - Intergenic
1173120771 20:40287204-40287226 GGCCCCAAGGAGCCCAGGTCTGG + Intergenic
1173901052 20:46589071-46589093 GCCCCCATGGGCCCAAGGCCAGG + Intronic
1175237489 20:57524924-57524946 GGCCGGAAAGGCCCAAGGGCGGG - Intronic
1176075010 20:63244441-63244463 GGCCCGAGGGGACGCAGGGCTGG - Intronic
1176295618 21:5070519-5070541 GGCCCCAAGGGACCCAGACAAGG - Intergenic
1179442352 21:41404073-41404095 GGACCAAGGGGACCAAGGCCCGG - Intronic
1179861431 21:44191605-44191627 GGCCCCAAGGGACCCAGACAAGG + Intergenic
1180954439 22:19735377-19735399 GGGCACACGGGAACAAGGGCTGG - Intergenic
1181460816 22:23084993-23085015 GGCCCCAAGGGACCCAGGACAGG - Intronic
1181522921 22:23459783-23459805 GGCCCCAGGGGACACAGGGCAGG - Intergenic
1182576442 22:31276475-31276497 GGCCGCAGGGGACAAAGGGCGGG + Intronic
1183821176 22:40346857-40346879 GGCCCCAGGAAAGCAAGGGCAGG + Intronic
1185097805 22:48821236-48821258 AGACCCTAGGGACCAAGGGCGGG - Intronic
1185108292 22:48886487-48886509 GGCTCCAGGAGAGCAAGGGCTGG - Intergenic
950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG + Intronic
950528852 3:13540747-13540769 GGGCCCCAGGGCCTAAGGGCCGG + Intergenic
952866345 3:37857725-37857747 AGCCCCAAGGGACCAAGGACAGG - Intergenic
953454701 3:43032387-43032409 GGCTCCATGGGACCAGGGTCTGG - Exonic
953876798 3:46671268-46671290 GGCCCCAGGGTCCCCAGGGCTGG + Intronic
954285430 3:49615758-49615780 GGCCCCCAGCCATCAAGGGCTGG - Intronic
954796134 3:53162008-53162030 GGCCTCCAGGGACCCAGGGGCGG - Intronic
955043200 3:55336354-55336376 AGCCCCCATGGGCCAAGGGCTGG + Intergenic
956106739 3:65827124-65827146 AGTCCCAAGGAACCAGGGGCTGG + Intronic
961079805 3:124016639-124016661 GACCACAAGGAGCCAAGGGCAGG - Intergenic
961303328 3:125936429-125936451 GACCACAAGGAGCCAAGGGCAGG + Intronic
961328865 3:126127398-126127420 GGCCCCAAGGGAGGGAGGGACGG - Intronic
961742432 3:129041023-129041045 GGCCCCAGGGGTCCTGGGGCCGG - Intergenic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
965558086 3:170037929-170037951 GGGCCCAACGAAACAAGGGCCGG - Exonic
966234538 3:177686246-177686268 GGCCACCAGGGCCCAATGGCGGG + Intergenic
968150842 3:196335578-196335600 GGGCCCAAGGGTCCTGGGGCAGG + Intronic
968448975 4:666277-666299 GCCCTCAGGGGACCACGGGCTGG + Intronic
973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG + Intronic
983015291 4:162605977-162605999 GGACCTAATGGACCCAGGGCAGG + Intergenic
985541810 5:490893-490915 GGCGCCAAGGAACCACGTGCTGG + Intronic
985675921 5:1231297-1231319 GGCCCCACAGGCCCCAGGGCAGG - Intronic
985903380 5:2814299-2814321 GGTCCGCAGGGCCCAAGGGCAGG + Intergenic
992644984 5:78803542-78803564 GGCCCCAGTGGACCAAGGCCAGG - Intronic
995565097 5:113426046-113426068 GTCCTCAAGGGACTGAGGGCTGG + Intronic
1000295437 5:159909323-159909345 GGCCCCAGGGGAGCAAGGCAAGG - Intergenic
1002534273 5:179867631-179867653 CTCCCCAGGGGACCACGGGCTGG - Intronic
1005709512 6:28489965-28489987 GGGCCCAGGGCACCCAGGGCAGG + Intergenic
1007379448 6:41478194-41478216 GGCCCACAGGGGCCAAGAGCTGG - Intergenic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1009332860 6:62445627-62445649 GGCACCATGGGGCCAGGGGCAGG + Intergenic
1009645452 6:66395693-66395715 GGTCCCTAGGTACAAAGGGCTGG + Intergenic
1011129433 6:84038136-84038158 GGCCACATGGGAGGAAGGGCTGG + Intronic
1018198769 6:161377002-161377024 GGCCCCGAGGAGCAAAGGGCAGG + Intronic
1018340655 6:162847621-162847643 GTCCCCAAGGTAAAAAGGGCAGG + Intronic
1019045055 6:169139469-169139491 GGCGCCAGGGGAACCAGGGCCGG + Intergenic
1019135010 6:169902511-169902533 GGTCCCAAGGCACCAAGACCGGG + Intergenic
1019409632 7:900868-900890 GGGCCGAAGGGCCGAAGGGCCGG + Intronic
1019443467 7:1059297-1059319 GCCCCCAGGGGACAGAGGGCTGG + Intronic
1019550159 7:1598191-1598213 GGCCCAGAGGGAGCAGGGGCTGG - Intergenic
1019588407 7:1816768-1816790 GGCCCCAGGGGACACAGGGCAGG + Intronic
1019891303 7:3949202-3949224 GCCCCCCAGGGACCCAGGGCTGG + Intronic
1020109464 7:5439938-5439960 GGGCCCTAGGGCTCAAGGGCAGG + Intronic
1020270143 7:6589980-6590002 GGCCCGCAGGGGCCAAGCGCAGG - Intergenic
1022124213 7:27340158-27340180 GGTCCCAATGGCCCAAGGACTGG + Intergenic
1022494648 7:30845177-30845199 GACTCCTAGGGACCAAGGGGTGG + Intronic
1023136348 7:37056616-37056638 GGCTGAAAGGCACCAAGGGCAGG + Intronic
1023393067 7:39729020-39729042 AGCCCCAAGGAACTCAGGGCAGG + Intergenic
1024038853 7:45533650-45533672 GACCACAATGGACCAAGGCCTGG + Intergenic
1024685877 7:51744652-51744674 GACCACCAGGGACCAAGGCCGGG + Intergenic
1029365042 7:100111318-100111340 GGACCTAAGGGAGAAAGGGCGGG + Exonic
1029970048 7:104780070-104780092 GGCCACTGGGGGCCAAGGGCTGG - Intronic
1033035669 7:137873849-137873871 GGCCCTAGGGTACCTAGGGCAGG + Intergenic
1034129488 7:148701673-148701695 GGCCCTCAGAGACCAAGGGATGG - Intronic
1035655036 8:1298994-1299016 GGGCCCAAGGGAGCAAAGGTGGG + Intergenic
1038163682 8:25064302-25064324 GGCACCATGGGAAAAAGGGCTGG - Intergenic
1039996915 8:42541820-42541842 GACCGCACGGGACCGAGGGCAGG - Exonic
1045717379 8:105064275-105064297 GGACCAAAAGTACCAAGGGCTGG - Intronic
1048465492 8:134661774-134661796 GCCCCCAAGGGAGCAAGGACAGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049098419 8:140562423-140562445 CGCCACACGGGACCAAGGGCGGG - Intronic
1049196967 8:141320994-141321016 GGCCCCAAAGCAGGAAGGGCTGG + Intergenic
1049219977 8:141424716-141424738 TGGCCCAAGGGACCTAGGACAGG + Intronic
1049343297 8:142125280-142125302 GGCCCCATGGAAGGAAGGGCAGG - Intergenic
1049410890 8:142473562-142473584 GGCCTCCAGGGCACAAGGGCGGG - Intronic
1049592330 8:143468311-143468333 GGCCGGCAGGGACCAAGGGCAGG + Intronic
1049661127 8:143820185-143820207 GGACCCAAGCGAGCAAGGGAAGG - Intronic
1049706671 8:144046286-144046308 GGCCTCCAGGGACTGAGGGCAGG - Intronic
1051367952 9:16334426-16334448 GGTCCCAAGGCTCCAGGGGCTGG + Intergenic
1053023269 9:34709986-34710008 GGACCCAAGGTACCAAGGCAGGG - Exonic
1057586631 9:96334228-96334250 GGCCTAAAGGGATCAAGGTCTGG + Intronic
1057704111 9:97385776-97385798 GCCCCCCAGGGACCCTGGGCCGG - Intergenic
1058651870 9:107182238-107182260 GCCCCCAAGGGCTCAAGGACTGG + Intergenic
1059115958 9:111600042-111600064 GGCCGGAAGGGTCCAAAGGCAGG + Intergenic
1060402007 9:123354806-123354828 GGTCCCCAGGGACCAAAGGAGGG - Intergenic
1060741896 9:126104245-126104267 GTCCCCCAGGGCCCAGGGGCTGG - Intergenic
1061202373 9:129145414-129145436 GTCCCGAAGGGCCCATGGGCTGG + Intronic
1061245697 9:129400443-129400465 GGGCCCAATGGACCAAGTGTTGG + Intergenic
1061913119 9:133735258-133735280 GGCCCCAAGGGAGCAGAGCCGGG - Intronic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062524423 9:136972505-136972527 AGGCCCAAGGGTCCAAGGCCAGG - Intergenic
1186504918 X:10083430-10083452 GGCCCCTCAGGACCAAGGCCAGG - Intronic
1187280805 X:17857474-17857496 GTCCACGAGGGACCAAAGGCTGG - Intronic
1187968944 X:24640342-24640364 GAGATCAAGGGACCAAGGGCAGG - Intronic
1190471163 X:50781036-50781058 AGCACCAATGGTCCAAGGGCAGG + Intronic
1191735695 X:64385910-64385932 GGCCTCTTGGGACCAAGTGCAGG - Intronic
1192484236 X:71511311-71511333 GGCCCCTAGGGACCTAGCCCTGG - Intronic
1193806150 X:85997310-85997332 ACCCCCTAGGGTCCAAGGGCAGG + Intronic
1195059095 X:101176995-101177017 GGAATCAAGGGACCAAGGACAGG - Intergenic
1196975911 X:121157452-121157474 TTCCACCAGGGACCAAGGGCAGG + Intergenic
1198313102 X:135438783-135438805 GCCCCCAAGGGACCATGCTCTGG - Intergenic
1199757752 X:150881129-150881151 GAGGTCAAGGGACCAAGGGCAGG - Intronic
1200067288 X:153509931-153509953 GGGCCCAATGGAGCCAGGGCAGG + Intergenic