ID: 1165956568

View in Genome Browser
Species Human (GRCh38)
Location 19:39505028-39505050
Sequence CATGTGACCCCAGAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 526}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165956568_1165956580 18 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956580 19:39505069-39505091 GAGTGGATCGAGGGGATGTCGGG 0: 1
1: 0
2: 2
3: 4
4: 99
1165956568_1165956577 9 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956577 19:39505060-39505082 AAGAATGTGGAGTGGATCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 156
1165956568_1165956574 -4 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956574 19:39505047-39505069 CATGGGCAGACAGAAGAATGTGG 0: 1
1: 0
2: 1
3: 42
4: 384
1165956568_1165956578 10 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956578 19:39505061-39505083 AGAATGTGGAGTGGATCGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 176
1165956568_1165956575 1 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956575 19:39505052-39505074 GCAGACAGAAGAATGTGGAGTGG 0: 1
1: 0
2: 7
3: 86
4: 684
1165956568_1165956581 21 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956581 19:39505072-39505094 TGGATCGAGGGGATGTCGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1165956568_1165956579 17 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956579 19:39505068-39505090 GGAGTGGATCGAGGGGATGTCGG 0: 1
1: 0
2: 0
3: 18
4: 245
1165956568_1165956576 8 Left 1165956568 19:39505028-39505050 CCTCCTCCCTCTGGGGTCACATG 0: 1
1: 0
2: 2
3: 35
4: 526
Right 1165956576 19:39505059-39505081 GAAGAATGTGGAGTGGATCGAGG 0: 1
1: 0
2: 1
3: 4
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165956568 Original CRISPR CATGTGACCCCAGAGGGAGG AGG (reversed) Intronic
900704842 1:4073961-4073983 CCTGTGAGCCCTGAGGGAAGGGG + Intergenic
900993792 1:6109667-6109689 GATGTCAGCCCAGAGGGCGGTGG - Intronic
901046621 1:6400211-6400233 CACTTGAACCCAGAGGGCGGAGG + Intergenic
901244230 1:7716114-7716136 CACGTGAGCCCAGAAGGTGGAGG - Intronic
901492477 1:9603482-9603504 CATGTGGGCCCTGAGGGAGTGGG - Intronic
902408624 1:16200015-16200037 CATCTGACCCCTGAAGGATGAGG - Intronic
902433091 1:16378808-16378830 CACTTGAACCCAGAGGGTGGAGG - Intronic
902761017 1:18580792-18580814 CACGTGGCCTCAGAGGGTGGGGG - Intergenic
903087506 1:20875826-20875848 CATGTGACCTCAGAAGGTTGAGG + Intronic
903176496 1:21584610-21584632 CACTTGAACCCAGAAGGAGGAGG + Intergenic
903254569 1:22085927-22085949 CACGTGAACCCAGAAGGCGGAGG - Intronic
903697277 1:25217216-25217238 CATGTGAGGACACAGGGAGGAGG + Intergenic
903731125 1:25496229-25496251 CACGTGAGCCCAGAAGGCGGAGG - Intronic
904238860 1:29131226-29131248 CAGGAGCCCACAGAGGGAGGGGG + Intergenic
904665432 1:32117254-32117276 CATTTGAACCCGGAGGGTGGAGG - Intronic
905212031 1:36381022-36381044 GAAGTGATGCCAGAGGGAGGAGG - Intronic
905293452 1:36939202-36939224 CATGTGCCCCCAGAGGGAGCGGG + Intronic
905421893 1:37852712-37852734 CACTTGAACCCAGAGGGCGGAGG - Intronic
905582884 1:39095477-39095499 CATTTGAACCCAGGAGGAGGAGG + Intronic
905640046 1:39582864-39582886 CACTTGAACCCAGAAGGAGGAGG + Intergenic
905750698 1:40460895-40460917 CATGTGAACCCAGGAGGTGGAGG + Intronic
905933598 1:41806761-41806783 CCTGGGACTCCAGAGGGAAGGGG + Intronic
906134535 1:43487597-43487619 CACTTGAACCCAGAAGGAGGAGG + Intergenic
907093014 1:51747051-51747073 CATTTTAACCCAGAGGGTGGAGG - Intronic
907182889 1:52586378-52586400 AAAGTGTCCCAAGAGGGAGGGGG + Intergenic
907449057 1:54530841-54530863 CACTTGAGCCCAGAGGGCGGAGG - Intergenic
908108864 1:60874908-60874930 GCTGTGAGGCCAGAGGGAGGGGG - Intronic
909393108 1:75137097-75137119 CAGGTGAGCCCCGAGGGAGCGGG + Exonic
909868503 1:80706635-80706657 CATGTGAACACAGAGGGATAAGG - Intergenic
910371749 1:86523893-86523915 CATGAGAGCCCACAGGGTGGGGG + Intergenic
910737242 1:90473290-90473312 CATTTGAACCCAGTGGGTGGAGG - Intergenic
910895254 1:92062499-92062521 CATTTGAACCCGGAGGGTGGAGG + Intronic
911485321 1:98498032-98498054 CTTGTGGCCCCATACGGAGGTGG + Intergenic
911617660 1:100032627-100032649 CATTTGAACCCGGAGGGTGGAGG - Intergenic
911691221 1:100837041-100837063 CATGTGAACCCAGAAGGCGGAGG - Intergenic
912797997 1:112704587-112704609 CATGTCACCTCAGGGGCAGGAGG + Intronic
912920974 1:113866829-113866851 CACTTGACCCCAGGGGGTGGAGG - Intronic
914872039 1:151482993-151483015 CATTTGAACCCGGAGGGTGGAGG + Intergenic
915354410 1:155247627-155247649 CAAGAGACCCCAGAGGTAGGAGG + Exonic
916412126 1:164556520-164556542 CACTTGAACCCAGAGGGTGGAGG + Intronic
917212758 1:172646828-172646850 CATGTGAACTCACAGGGAGGAGG + Intergenic
917562428 1:176173225-176173247 CATGTGAGCCCAGGAGGTGGAGG + Intronic
918180570 1:182083347-182083369 CACTTGAACCCAGGGGGAGGTGG + Intergenic
918533702 1:185551228-185551250 CATGTGCCCTCAGAGGTGGGTGG + Intergenic
918636082 1:186775974-186775996 CCTCTGAAGCCAGAGGGAGGAGG - Intergenic
920010050 1:202860940-202860962 AATGTGATCTCAGAGGGAGGCGG + Intergenic
920327135 1:205174427-205174449 CACTTGAACCCAGAAGGAGGAGG + Intronic
921031431 1:211338251-211338273 CACCTTACCCCAGAGGAAGGGGG - Intronic
921936619 1:220802011-220802033 CATGTGTCCTCAGAGCGGGGTGG - Intronic
922121545 1:222674225-222674247 CAGGTGACCACAGAGGCATGTGG + Intronic
923537189 1:234862444-234862466 AATGTGACCCCGGAGGGATGGGG + Intergenic
924635113 1:245779074-245779096 CACTTGAACCCAGAAGGAGGAGG + Intronic
1063566759 10:7177930-7177952 CATGTGAGGGCAGAGGGAGAAGG + Intronic
1063981353 10:11454466-11454488 CATGTGACCCAGGAGGGAGGAGG - Intronic
1064565274 10:16633191-16633213 CAAGTGTCCCCAGCGGGAGTGGG + Intronic
1064990295 10:21250807-21250829 CACTTGAACCCAGAAGGAGGAGG + Intergenic
1065513682 10:26504624-26504646 CATTTGAGCCCAGAAGGCGGAGG + Intronic
1065637192 10:27744330-27744352 CCGGAGACCCCAGAGAGAGGCGG - Intronic
1066049822 10:31622742-31622764 CATGGGACCCCAGAGTGAGCAGG - Intergenic
1069699792 10:70414782-70414804 CACTTGAACCCAGAGGGTGGAGG + Intronic
1070851178 10:79562608-79562630 GATGTCCCCGCAGAGGGAGGTGG - Intergenic
1071103643 10:82068673-82068695 GAGGTGACACCAGAGGGAGCGGG + Intronic
1071461698 10:85902963-85902985 CATGTGAAGCCAGAGAAAGGAGG - Intronic
1072134095 10:92526760-92526782 CATTTGAGCCCAGGAGGAGGAGG + Intronic
1072665468 10:97389481-97389503 CATGTGAGCACCGAGGGAAGGGG + Intronic
1073407664 10:103312000-103312022 CACTTGACCCCAGGAGGAGGAGG + Intronic
1074411992 10:113236393-113236415 CATGTGACCCCGTAGGGTCGCGG + Intergenic
1075335010 10:121602430-121602452 CATTTGAACCCTGAGGGTGGAGG - Intergenic
1075599839 10:123759442-123759464 AATGAGAAACCAGAGGGAGGTGG + Intronic
1075691349 10:124396809-124396831 CATGTGAGCCCAGGAGGTGGAGG + Intergenic
1075924815 10:126242798-126242820 CATGTGAACCCAGAGCTGGGAGG - Intronic
1076444849 10:130507386-130507408 CATGTGGCCCCAGAGGAGGAGGG + Intergenic
1076547324 10:131254074-131254096 CATGAGACACCAGGGGGTGGAGG + Intronic
1076654632 10:132015570-132015592 CATTTGAACCCAGGAGGAGGAGG - Intergenic
1076744118 10:132504247-132504269 CAGCTGACCCCAGAAGGAGCTGG - Intergenic
1076795567 10:132796543-132796565 CATGTGACCCCTGAGAGTGCTGG - Intergenic
1076839413 10:133038717-133038739 GAGGTGACCCAGGAGGGAGGTGG - Intergenic
1076903316 10:133350459-133350481 CCCGTGACCCCAGGTGGAGGAGG + Intronic
1077026954 11:444259-444281 CATTTGAACCCGGAGGGTGGAGG + Intergenic
1077369023 11:2172908-2172930 CTGCTGACCCCAGAGGGATGGGG - Intergenic
1077481743 11:2818215-2818237 CAGGTGACCCAAGAGTGTGGGGG + Intronic
1077561215 11:3262740-3262762 CATGTGAAGACAGAGGGAGCAGG + Intergenic
1077567109 11:3308569-3308591 CATGTGAAGACAGAGGGAGCAGG + Intergenic
1080563883 11:33490405-33490427 CACTTGAGCCCAGAGGGCGGAGG - Intergenic
1081646598 11:44794582-44794604 CATTTGAACCCAGAAGGCGGAGG + Intronic
1083304104 11:61753837-61753859 GATGGGACCGCAGTGGGAGGGGG + Intronic
1083603685 11:63964175-63964197 CATTTGAACCCAGAAGGTGGAGG - Intergenic
1083849415 11:65356253-65356275 GATGTGAGCCCCGGGGGAGGTGG - Exonic
1083857745 11:65401404-65401426 GATGTGACCCAAGTGGGAGAGGG - Intronic
1084216654 11:67650584-67650606 CACGTGGCCCCAGAGGGTTGAGG + Exonic
1084399906 11:68937435-68937457 CATGTGGCCCTGGAGGGTGGAGG + Intronic
1085228163 11:74941494-74941516 AATGTGACCCAAGAAGGAGAGGG + Intronic
1086245217 11:84743806-84743828 CATTTGAACCCAGAGAGTGGAGG - Intronic
1086335822 11:85799753-85799775 GATGTGAGCACAGAGGAAGGAGG - Intronic
1086734009 11:90283449-90283471 CATATGTCGCCAGAGGGAAGTGG - Intergenic
1086815905 11:91370392-91370414 CATGTGGGCCCAGAATGAGGAGG + Intergenic
1087173198 11:95071645-95071667 CAGGTGACCCAATAGGAAGGTGG - Intergenic
1088033632 11:105284077-105284099 CTTGCCACCGCAGAGGGAGGAGG + Intergenic
1088750061 11:112835806-112835828 CATCTGGGTCCAGAGGGAGGGGG - Intergenic
1089060520 11:115622551-115622573 CATGTGCCCCCAGATGGTGCAGG + Intergenic
1089247947 11:117136367-117136389 CATGAGACCCCAGGGGAAAGGGG + Intergenic
1089258767 11:117208194-117208216 CATGAGACCCCAGGGGAAAGGGG - Intronic
1089391995 11:118108570-118108592 CCTGGGACCCAAGAGGGAAGAGG - Intronic
1089432914 11:118437326-118437348 CATCTGCCCAGAGAGGGAGGCGG - Intronic
1089810296 11:121125963-121125985 CTTGTGACCCAAGAATGAGGGGG + Intronic
1090313896 11:125768096-125768118 CATGAGACTTCAGAGGGAGTAGG + Intergenic
1090710542 11:129380858-129380880 CATTTGAACCCAGAAGGTGGAGG - Intronic
1091049248 11:132352661-132352683 CAGGTGACACCAGAGGGAACCGG + Intergenic
1091927967 12:4370840-4370862 CATGTGGCCCCAGGAGGAGCTGG - Intronic
1093372684 12:18383885-18383907 CATTGGACCCCAGAAGGTGGAGG - Intronic
1094428273 12:30338564-30338586 CATGTGAGTCCAGGTGGAGGTGG + Intergenic
1096631841 12:52932175-52932197 CACTTGAACCCAGAGGGTGGAGG - Intronic
1097110938 12:56657589-56657611 CATGTGAACCCAGAGGGTAGAGG - Intergenic
1097218915 12:57435355-57435377 AGAGTGACCCCAGAGGGATGTGG - Intronic
1098153206 12:67569691-67569713 CATGTGAGCACACAGGGAGATGG - Intergenic
1098430663 12:70416250-70416272 TATGGGACCCCAGATGAAGGAGG + Intronic
1099028481 12:77495323-77495345 CATGTGAGGACAGAGGGAGAAGG - Intergenic
1099192341 12:79573321-79573343 CACTTGAACTCAGAGGGAGGAGG + Intergenic
1100657306 12:96660742-96660764 CATCAGACCCCAGAGGTTGGGGG + Intronic
1101560381 12:105852148-105852170 CATTTGAACCCAGAAGGCGGAGG - Intergenic
1102271836 12:111543515-111543537 CATTTGAACCCAGAAGGTGGAGG - Intronic
1102389619 12:112539042-112539064 GGTGTGTCCCCAGAGAGAGGTGG - Intergenic
1102438795 12:112946094-112946116 TTTGTCACCCCAGAGAGAGGGGG + Intronic
1105414776 13:20200709-20200731 CATTTGAACCCAGTGGGCGGAGG + Intergenic
1105443198 13:20432164-20432186 CATGCGAGTCCAGAAGGAGGTGG - Exonic
1106082023 13:26508154-26508176 CATGTGCCCTCAGCGGGAGGTGG - Intergenic
1106405291 13:29468033-29468055 CATGTGAGCCCAGGAGGTGGAGG + Intronic
1107559305 13:41545826-41545848 CATTTGAACCCAGAAGGAGAAGG - Intergenic
1107914220 13:45132801-45132823 CAGGTCAGCACAGAGGGAGGAGG + Intronic
1108698118 13:52920739-52920761 TGTGTGACCCCGGAGGTAGGGGG + Intergenic
1109283420 13:60383577-60383599 CATGTGACCATAGAGGCGGGAGG + Intergenic
1109431133 13:62237152-62237174 CACTTGAACCCAGAGGGTGGAGG - Intergenic
1111469216 13:88655636-88655658 CATGTGGCTCCAGGGGGAGAGGG + Intergenic
1112108664 13:96270192-96270214 CATGTGAGCACACAAGGAGGAGG + Intronic
1114326125 14:21590494-21590516 CACTTGACCCCAGAAGGTGGAGG + Intergenic
1115274448 14:31592003-31592025 CAAGTGAACCGAGATGGAGGAGG + Intronic
1115353775 14:32425504-32425526 CATGTGAACCCAGGAGGAAGAGG + Intronic
1117495985 14:56304661-56304683 CATGTGGCCCCACATGGAGATGG + Intergenic
1117522136 14:56561362-56561384 CACTTGAACCCAGAGGGTGGAGG + Intronic
1118032845 14:61835340-61835362 CACTTGAACCCAGAAGGAGGAGG - Intergenic
1119259082 14:73226778-73226800 CAGATGTCCCCTGAGGGAGGAGG - Intergenic
1119289463 14:73483464-73483486 CATGTGAGGCCAGAGACAGGAGG - Intronic
1119578908 14:75756589-75756611 CACTTGAACCCAGAAGGAGGAGG - Intronic
1120306159 14:82773211-82773233 CATTTGAACCCAGGGGGTGGAGG + Intergenic
1120489465 14:85158368-85158390 CATGTGACCAGAGGGGGAGAGGG + Intergenic
1121612683 14:95292459-95292481 CCTGTGACCCAAGATGCAGGGGG - Intronic
1122639746 14:103152053-103152075 CACTTGAACCCAGAGGGCGGAGG - Intergenic
1122986572 14:105214351-105214373 CGAGTGACCACAGAGTGAGGAGG + Intronic
1202895208 14_GL000194v1_random:2709-2731 CATGTCACCTGAGAGGGATGAGG + Intergenic
1124202813 15:27693012-27693034 CATGTGTGCCCACAGGGAAGGGG + Intergenic
1125023669 15:35009342-35009364 CATTTGAACCCGGAGGGTGGAGG - Intergenic
1125633492 15:41167825-41167847 CACTTAACCCCAGAGGGTGGAGG + Intergenic
1126472010 15:49022516-49022538 CATTTGAACCCAGGAGGAGGAGG + Intronic
1126793024 15:52238107-52238129 CATGTGAAGACAGAGGGAGGTGG + Intronic
1127118475 15:55750280-55750302 CATGTGAACCCAGGAGGCGGAGG + Intergenic
1128167986 15:65484240-65484262 CATGTGAACCCAGAAGGCAGAGG + Intronic
1128248390 15:66148531-66148553 CATTTGACCACAGAGGGACCTGG - Intronic
1128385330 15:67143851-67143873 CATGTGAACCCAGGAGGCGGAGG - Intronic
1128519694 15:68367198-68367220 CATTTCTCTCCAGAGGGAGGAGG - Intronic
1128919415 15:71596803-71596825 CATGTAGCAGCAGAGGGAGGTGG + Intronic
1129335451 15:74849658-74849680 CATTTGAACCCAGGAGGAGGAGG + Intronic
1129656243 15:77527343-77527365 CCTGGGGCCCCTGAGGGAGGAGG - Intergenic
1130061673 15:80574873-80574895 CCAGTGATTCCAGAGGGAGGGGG + Intronic
1130674082 15:85937105-85937127 CCTGTGACCCCACATGCAGGGGG + Intergenic
1132066238 15:98733302-98733324 CACTTGAGCCCAGAGGCAGGAGG - Intronic
1132068951 15:98758585-98758607 CAGGTGAAACCAGAGGGAAGGGG - Intronic
1132251707 15:100340265-100340287 CAGGTGCTCCCAGGGGGAGGGGG - Intronic
1132796904 16:1729053-1729075 GTTGTAACCACAGAGGGAGGGGG - Intronic
1133371801 16:5250960-5250982 CATGTGAGCCCTGGGGGAGCCGG - Intergenic
1133802394 16:9093717-9093739 CATGTCATCACAAAGGGAGGGGG - Intronic
1133950535 16:10387984-10388006 CACTTGAACCCGGAGGGAGGAGG - Intronic
1133998895 16:10767265-10767287 CATGTTATCCCAGAGCCAGGTGG - Exonic
1134159333 16:11873669-11873691 CACTTGAACCCAGAAGGAGGAGG - Intronic
1134405999 16:13959194-13959216 CATTTGAACCCAGGAGGAGGAGG + Intergenic
1135095443 16:19561019-19561041 AATATGACCCCAGAGGGACTAGG + Intronic
1135546327 16:23369473-23369495 CACATGAGCCCCGAGGGAGGGGG - Intronic
1135742453 16:24987682-24987704 CCTGTGAGCCCAGAGGCAGTGGG - Intronic
1137249870 16:46733565-46733587 TTTGTGAGCCCAGATGGAGGTGG + Intronic
1137445517 16:48529570-48529592 CATGTGGCCATGGAGGGAGGAGG - Intergenic
1137569710 16:49557505-49557527 CCTCTGACCCCAGGGGGTGGTGG + Intronic
1138345073 16:56315707-56315729 CCTGGGCCCCCAGAGGCAGGGGG - Intronic
1138609811 16:58114099-58114121 CAAGTGTCACCAGAGGCAGGGGG - Intronic
1138814071 16:60183961-60183983 CACTTGAACCCAGAGGGTGGAGG + Intergenic
1139215572 16:65122337-65122359 CATCTGAGCCCTGAGGGAGTCGG - Intronic
1139326701 16:66158105-66158127 AATGAGACCCCACAGGAAGGTGG + Intergenic
1139625675 16:68186970-68186992 CAAGTGGCCCCAGAGGGCTGTGG - Intronic
1141114133 16:81293754-81293776 CACGTGAACCCAGGGGGCGGAGG + Intergenic
1141369151 16:83471356-83471378 CATTTGAACCCGGAGGGTGGAGG - Intronic
1142246060 16:88970594-88970616 CCTGTGGCCCCGGAGGGAAGGGG - Intronic
1142291810 16:89196523-89196545 CATGTGACTCCAGAGTGAGCAGG + Intronic
1142357405 16:89608404-89608426 CAAGTGACTCCAGAGGGAGCCGG - Intergenic
1142942622 17:3395270-3395292 CATGTGAGCCCAGGAGGCGGAGG + Intergenic
1143332267 17:6146375-6146397 CATGTGACCCCATCAAGAGGTGG - Intergenic
1143443030 17:6990376-6990398 CACTTGACCCCAGGAGGAGGAGG + Intronic
1143792205 17:9306679-9306701 CACGTGAACCCAGAAGGCGGAGG + Intronic
1144812862 17:18011904-18011926 CATGTGAACCCAGGTGGTGGAGG - Intronic
1144854007 17:18258285-18258307 CGTGTGACCTCAGAGGGGCGGGG + Intronic
1145275962 17:21430660-21430682 CATGTGACCACGGAGGCAGAGGG + Intergenic
1146125041 17:30224727-30224749 CATTTGGCCCCTGAGGCAGGAGG - Intronic
1146848726 17:36203118-36203140 CACTTGAACCCAGGGGGAGGGGG - Intronic
1147186941 17:38718014-38718036 CATGTGACCCCAGAAAGAATGGG + Intronic
1147445351 17:40471930-40471952 CATGTGAGCACACAGGGAGAAGG + Intergenic
1147727225 17:42573630-42573652 CAAGTGACCCCAGGCGGATGTGG - Intronic
1148272885 17:46277728-46277750 CATTTGAACCCAGGAGGAGGAGG - Intronic
1148444614 17:47730029-47730051 CACTTGACCCCAGGAGGAGGAGG - Intergenic
1148584731 17:48769323-48769345 CATGGGACCCTACTGGGAGGTGG - Intronic
1148745406 17:49915303-49915325 CTTCTGACCCTAGAGGGAGCTGG - Intergenic
1148849753 17:50548819-50548841 CATGTGGCACCAGTGGCAGGTGG - Exonic
1148858142 17:50590382-50590404 CATGGGACACCAGGGAGAGGAGG - Intronic
1148925048 17:51076650-51076672 CACTTGACCCCAGGGGGCGGAGG + Intronic
1149707905 17:58712259-58712281 CATTTGAACCCAGAAGGCGGAGG + Intronic
1149923682 17:60681633-60681655 CATTTGAACCCAGAAGGCGGAGG - Intronic
1150457588 17:65319944-65319966 CATGTCACCCCAGAGAGAAAAGG - Intergenic
1151087051 17:71392121-71392143 CACTTGAACCCAGAGGGTGGAGG + Intergenic
1151424627 17:74023034-74023056 AATGTTAAACCAGAGGGAGGCGG - Intergenic
1151701850 17:75747393-75747415 CATTTGAACCCAGTGGGTGGAGG + Intronic
1152066919 17:78117218-78117240 CAGGTGACCTGAGAGGGTGGGGG + Intronic
1152562452 17:81085371-81085393 CATGGGACAGCAGAGGAAGGAGG + Intronic
1152573157 17:81129216-81129238 CAGGAGAGCCCAGGGGGAGGGGG + Intronic
1152612659 17:81323251-81323273 CCGGTGACCCCAGAGTGAGAGGG - Intronic
1152743733 17:82029873-82029895 GGTGTGACCGAAGAGGGAGGAGG + Intronic
1153053637 18:924741-924763 CACTTGAACCCAGAGGGTGGAGG - Intergenic
1153287460 18:3469573-3469595 TACGTGAGCCCAGAGGGAGAAGG - Intergenic
1154337190 18:13475084-13475106 GACGTGACTCCAGAGGGAAGTGG + Intronic
1155457893 18:26040456-26040478 CATGTCACTCAAGGGGGAGGAGG - Intronic
1155669000 18:28346796-28346818 GAAGGGACTCCAGAGGGAGGAGG + Intergenic
1155952453 18:31928070-31928092 CGTGTGAACCCAGGGGGAAGAGG + Intronic
1156223322 18:35076485-35076507 CATCTGACTTAAGAGGGAGGGGG - Intronic
1156446193 18:37238736-37238758 CATGTGAGCCCAGAGGAGGAAGG + Intergenic
1156755709 18:40522004-40522026 CGTGTGAACCCAGAGGGCGGAGG + Intergenic
1157744922 18:50127051-50127073 CATAAGACCCAAGAGGCAGGTGG + Intronic
1157863274 18:51160443-51160465 CATTTGAACCCAGAAGGTGGAGG - Intergenic
1158316294 18:56214461-56214483 CACTTGAACCCAGGGGGAGGAGG - Intergenic
1159212462 18:65343397-65343419 CATGTGAAGACAGAGGGAGAAGG + Intergenic
1159374617 18:67577124-67577146 CATGTAACATCAGAGGGATGTGG + Intergenic
1159601704 18:70434053-70434075 CATGTGAGCCCACAGCGAGAAGG + Intergenic
1159653113 18:71000591-71000613 CATGTGAATCCATAGGGAGAAGG - Intergenic
1160364614 18:78313586-78313608 CATGAGACCACAGAGGCAGTAGG + Intergenic
1160367054 18:78335434-78335456 CCTATGAGGCCAGAGGGAGGAGG + Intergenic
1161322339 19:3647045-3647067 CAGGTGCTCACAGAGGGAGGAGG + Intronic
1161488863 19:4550769-4550791 CATGTGACTCAGGATGGAGGGGG + Intronic
1162127764 19:8508511-8508533 CATGTGAACCCAGAAGGCGGAGG + Intergenic
1162288534 19:9760207-9760229 CACTTGAACCCAGAGGGTGGAGG + Intronic
1162336336 19:10062808-10062830 CACTTGAACCCAGAAGGAGGAGG + Intergenic
1162822464 19:13231370-13231392 CAGGTGCCCCCAGGGGGTGGGGG - Intronic
1163105660 19:15121723-15121745 CACTTGAACCCAGGGGGAGGCGG + Intronic
1163299919 19:16438267-16438289 CACTTGAACCCAGAGGGTGGAGG + Intronic
1163586641 19:18168000-18168022 CCTGAGGCCCAAGAGGGAGGTGG - Intronic
1163691275 19:18739773-18739795 CCTGAGACCCCAGAGAAAGGAGG + Intronic
1163700037 19:18782364-18782386 TGTGTCACCCCTGAGGGAGGAGG - Intergenic
1163778045 19:19229385-19229407 CAGGCGAGACCAGAGGGAGGAGG + Intronic
1164520189 19:28973186-28973208 ACAGTGACACCAGAGGGAGGAGG + Intergenic
1164583302 19:29448634-29448656 CATGTGACGAGAGAGGGAGAAGG - Intergenic
1165238532 19:34444139-34444161 CATTTGAACCCAGAAGGCGGAGG - Intronic
1165556394 19:36636266-36636288 CACTTGAACCCAGAGGGCGGAGG - Intergenic
1165948541 19:39459461-39459483 GATGTGAAACCAGAGGAAGGGGG + Intronic
1165956568 19:39505028-39505050 CATGTGACCCCAGAGGGAGGAGG - Intronic
1166051034 19:40260066-40260088 CATGTGAACCCAGGAGGTGGAGG + Intronic
1167163374 19:47781496-47781518 CGTGTGTCCCCAGAGCGAGCGGG + Intronic
1167328404 19:48838681-48838703 CATTTGAACCCAGAAGGCGGAGG + Intronic
1167514769 19:49916806-49916828 CCTGTGATCCCAGATAGAGGTGG + Intronic
1167622396 19:50567313-50567335 GGGGTGACCCCAGAGGGAGAAGG + Intronic
1167864741 19:52315397-52315419 CATTTGACCCCAGGAGGCGGAGG - Intronic
1168081038 19:54010656-54010678 CATTTGAGCCCAGAAGGATGAGG - Intronic
1168111339 19:54192919-54192941 CATGTGAACCCAGGGGGCAGAGG + Intronic
1168358148 19:55715128-55715150 CATTTGAGCCCAGATCGAGGAGG + Exonic
925018978 2:553710-553732 CCTGTGCCCCCAGGAGGAGGTGG + Intergenic
925018992 2:553741-553763 CCTGTGCCCCCAGGAGGAGGTGG + Intergenic
925050853 2:814307-814329 AATTTGAGCCCAGAGGCAGGAGG + Intergenic
926698236 2:15785336-15785358 CATGTGAACTCAGTGAGAGGAGG + Intergenic
926854898 2:17244706-17244728 CATGTGACCGCACATGAAGGTGG + Intergenic
927243588 2:20939260-20939282 TATGTGGCCCCAGAGGGCAGGGG + Intergenic
927358169 2:22199027-22199049 CAAGTGACAAAAGAGGGAGGGGG - Intergenic
927553676 2:24018367-24018389 CACCTGACCGCACAGGGAGGTGG - Intronic
927664914 2:25024724-25024746 CACTTGAACCCAGAGGGTGGAGG - Intergenic
928561932 2:32498143-32498165 CACGTGAACCCAGAAGGCGGAGG - Intronic
930040287 2:47117291-47117313 CACTTGAACCCAGAAGGAGGAGG - Intronic
930599331 2:53425074-53425096 CAAGAGGCCCCAGGGGGAGGAGG + Intergenic
932670199 2:73730991-73731013 CACTTGGCACCAGAGGGAGGAGG - Intronic
932821285 2:74903388-74903410 CATTTGAACCCGGAGGGTGGAGG - Intergenic
933633922 2:84686102-84686124 CATGTGAACCCAGGAGGCGGAGG + Intronic
933816562 2:86073414-86073436 TATCTGACCCCAGAGGAATGAGG + Intronic
934731036 2:96658098-96658120 CATGTGAACCCAGGAGGGGGAGG - Intergenic
935420379 2:102862338-102862360 CATGTGAGCACAGAGTGAGAAGG - Intergenic
936004517 2:108871466-108871488 CCCTTGAACCCAGAGGGAGGAGG + Intronic
936639807 2:114299330-114299352 CAGATGACACCAGAGGGAGAAGG - Intergenic
937305360 2:120867446-120867468 CAAGTGGCCGCCGAGGGAGGCGG - Intronic
938104603 2:128521265-128521287 CCTTTGCCCCCAGAGGAAGGTGG - Intergenic
938593817 2:132766385-132766407 CATGAAAGCCCAGAGGGAGGTGG - Intronic
938607967 2:132915845-132915867 AATCTGACCCCAGAGGCAGATGG + Intronic
939601311 2:144194398-144194420 CATAGGAGCCCAGAGGGACGAGG - Intronic
939787727 2:146537692-146537714 TATGTGACCACACAGGGAGATGG + Intergenic
941885638 2:170524565-170524587 CACTTGAACCCAGAGGGCGGAGG - Intronic
941940835 2:171035727-171035749 CATGTGTGCCCAGAGGGAAGGGG + Intronic
942372584 2:175301046-175301068 CATGAGACCTCAGAAGGAGATGG - Intergenic
943733830 2:191332044-191332066 CACTTGAACCCAGAGGGTGGAGG - Intronic
944645180 2:201772943-201772965 CATGTGAACCCAGGAGGTGGAGG - Intronic
944851599 2:203725204-203725226 CACCTGAACCCAGAGGGCGGAGG + Intronic
945037806 2:205718856-205718878 CACTTGAACCCAGAAGGAGGAGG + Intronic
945146956 2:206748293-206748315 CACTTGAACCCAGAAGGAGGGGG + Intronic
945215317 2:207427575-207427597 CATTTGACCCCAGAAGGCAGAGG + Intergenic
945437989 2:209841437-209841459 CATTTGAACCCAGAAGGCGGAGG - Intronic
945805662 2:214487084-214487106 CATGTGAAGACAGAGGAAGGCGG + Intronic
946168079 2:217877531-217877553 CATAAAACCCGAGAGGGAGGGGG - Intronic
946374158 2:219298094-219298116 CTTGTTCCCACAGAGGGAGGAGG - Exonic
946668133 2:222072759-222072781 CACGTGAACCCAGAAGGCGGAGG + Intergenic
946858695 2:223978970-223978992 CATGTGAGGACACAGGGAGGGGG + Intronic
947617421 2:231567375-231567397 CATGTGAGGCCACAGGGAGAAGG + Intergenic
1169099440 20:2933542-2933564 CATTTGACCCCAGAAGGTGGAGG - Intronic
1170102732 20:12720189-12720211 CATGTGAACACATAGGGAGATGG + Intergenic
1170548893 20:17458553-17458575 AATGAGAGCCCAGAGGGATGAGG + Intronic
1170571336 20:17634478-17634500 CAAGTGACCTAGGAGGGAGGCGG + Intronic
1170892027 20:20384172-20384194 CATGTGAGGACACAGGGAGGAGG - Intergenic
1170940842 20:20846685-20846707 AATGTCACCCCCGAGGGAGCAGG - Intergenic
1171078846 20:22156840-22156862 CATGTGCCCCTAGGGGGATGGGG + Intergenic
1171948532 20:31400274-31400296 CATGTGAACCCAGGAGGCGGAGG - Intergenic
1172215568 20:33233347-33233369 CATGAGACCCCAGGGAGAGAAGG + Intergenic
1172250289 20:33474736-33474758 CAGGGGATGCCAGAGGGAGGAGG + Intergenic
1172453880 20:35050627-35050649 CATTTGAGCCCAGAAGGTGGAGG + Intronic
1172488397 20:35314357-35314379 CATGTGCTCCCAGAGAGAGGAGG - Intronic
1172536990 20:35681612-35681634 CATTTGAACCCAGAGTGAGGAGG + Intronic
1172653670 20:36523745-36523767 CATTTGAACCCAGCGGGTGGAGG - Intronic
1172901913 20:38341454-38341476 CATTTGAACCCAGAAGGCGGAGG + Intergenic
1173156700 20:40619243-40619265 CATGTGAAGGCACAGGGAGGAGG - Intergenic
1173624520 20:44462505-44462527 CATTTGAACCCAGAAGGTGGAGG + Intronic
1173678958 20:44862552-44862574 CATGTGGCCCCAAATGGAGCAGG - Intergenic
1174136632 20:48384702-48384724 GACGTCACCTCAGAGGGAGGGGG - Intergenic
1174383341 20:50171662-50171684 CATGTGAGCCCAGAGCAAGAAGG + Intergenic
1174597101 20:51692947-51692969 ACTGTGTCCCCTGAGGGAGGAGG - Intronic
1174799211 20:53549013-53549035 CACTTGAGCCCAGAGGGTGGAGG + Intergenic
1175308478 20:57994408-57994430 CACCTGGCCACAGAGGGAGGGGG - Intergenic
1175438553 20:58973296-58973318 AAAGTGACCCCAGGGGCAGGAGG - Intergenic
1175532240 20:59681924-59681946 CATTTGAACCCAGGGGGTGGAGG + Intronic
1175786305 20:61713712-61713734 CATGTGAGCAGCGAGGGAGGGGG + Intronic
1175991795 20:62793530-62793552 CAGGGGACCCCCAAGGGAGGAGG + Intergenic
1176301736 21:5101903-5101925 CATGAGTCACCAGAGAGAGGGGG - Intergenic
1176614910 21:9018696-9018718 CATGTCACCTGAGAGGGATGAGG + Intergenic
1177051623 21:16241969-16241991 AATCTCACCACAGAGGGAGGTGG - Intergenic
1177121636 21:17144192-17144214 CAACTGCCCCTAGAGGGAGGGGG - Intergenic
1178131357 21:29575746-29575768 CATTTGAACCCGGAGGGTGGAGG + Intronic
1178404527 21:32313226-32313248 CCTGTGCCCCCAGAGGCATGGGG + Exonic
1178506435 21:33166884-33166906 CATGTGACGACAGAGTCAGGAGG + Intronic
1179442982 21:41408551-41408573 TATGAGACCCCAGAGGGGGAAGG + Exonic
1179450698 21:41466573-41466595 CAGATGACCCCAGGAGGAGGAGG - Intronic
1179558429 21:42195303-42195325 CAAGTGCACCCAGAGGTAGGTGG + Intergenic
1180001387 21:44997021-44997043 CGGGTGCCCCCAGAGGAAGGTGG + Intergenic
1180012653 21:45061228-45061250 CTTGGGAACCCAGAGGCAGGGGG - Intergenic
1180050664 21:45329623-45329645 CATCTGGCCCCAGAGGGACCGGG - Intergenic
1181493362 22:23274526-23274548 CATGAGACCCCTGAGGCCGGGGG - Intronic
1182100122 22:27651711-27651733 CATAGTACACCAGAGGGAGGTGG + Intergenic
1183322877 22:37175885-37175907 CAGGTGTCCCAAGAGGGATGAGG + Intergenic
1183662949 22:39232123-39232145 CATGTGCCAGCAGAGGGAAGCGG - Intronic
1183784054 22:40019072-40019094 CCAGTGACCCCAGGGCGAGGTGG + Intronic
1183952122 22:41357842-41357864 GATTTGCCCCCAGGGGGAGGGGG - Exonic
1184483205 22:44760116-44760138 CATGAGACCCCCGAAGGTGGCGG - Intronic
1184515141 22:44957097-44957119 GCTGTGAGCTCAGAGGGAGGAGG - Intronic
1184654527 22:45934434-45934456 CATGTGTCACCCGATGGAGGGGG + Intronic
1184842888 22:47063014-47063036 GTGGTGACCCCAGAGGAAGGAGG + Intronic
1184941887 22:47774208-47774230 CATGTGGCCACAGAAAGAGGAGG + Intergenic
949568159 3:5264752-5264774 CATTTGAACCCAGAAGGTGGAGG - Intergenic
950557458 3:13704132-13704154 GATGGGACCCCAGTGTGAGGAGG + Intergenic
950674320 3:14545410-14545432 CATGTGAACACAGAGTCAGGAGG + Intergenic
950872376 3:16240870-16240892 CAGGTGAGTCCAGAGGGTGGAGG - Intergenic
951209885 3:19963726-19963748 CATTTGAGCCCAGGGGGTGGAGG - Intronic
952255105 3:31688206-31688228 CGTGTGAGACCAGAGGGAGGTGG - Intronic
952305758 3:32144767-32144789 CATTTGAGCCCAGGGGGCGGAGG - Intronic
952603973 3:35121543-35121565 CATGTGAGCTCAGATGTAGGTGG + Intergenic
953648738 3:44779748-44779770 CATTTGAACCCGGAGGGTGGAGG + Intronic
954003585 3:47576540-47576562 CATTTGAACCCGGAGGGTGGAGG - Intronic
954816911 3:53289526-53289548 CATTTGAACCCAGAAGGTGGGGG + Intronic
955145038 3:56309081-56309103 CATGTGGCCCCAGTGTGTGGTGG + Intronic
955473517 3:59312339-59312361 AATGTGAAGCCAGAGGCAGGCGG + Intergenic
956230164 3:67005757-67005779 CATGTGAACCCAGGAGGCGGAGG - Intronic
956820825 3:72952690-72952712 CATGTGAGGACAGAGGGAGAAGG - Intronic
957310851 3:78516772-78516794 CATGTGAGGACAGAGTGAGGAGG - Intergenic
958587477 3:96108000-96108022 CATTTGAACCCAGAAGGTGGAGG + Intergenic
959069335 3:101688054-101688076 CGTTTGAACCCAGAGGGCGGAGG - Intergenic
959723308 3:109516082-109516104 GAAGTGACTCCAGAGGGAAGGGG + Intergenic
960636199 3:119787202-119787224 CATTTGAACCCAGAAGGTGGAGG + Intronic
961410935 3:126719962-126719984 CATTTGACCCCAGGAGGTGGAGG - Intronic
962467155 3:135671045-135671067 CATGTGAACCCAGGAGGTGGAGG - Intergenic
962552625 3:136510693-136510715 CACTTGAACCCAGAGGGCGGAGG - Intronic
963225657 3:142859144-142859166 CATTTGAACCCAGGAGGAGGAGG - Intronic
963467320 3:145699731-145699753 CATTTGAACCCAGGGGGTGGAGG + Intergenic
963885252 3:150574127-150574149 CACTTGAGCCCAGAAGGAGGAGG + Intronic
964469357 3:157035813-157035835 CATTTGAACCCAGAAGGTGGAGG + Intronic
964552784 3:157903647-157903669 CAACTGACCCCAGAGTGAGATGG - Intergenic
965071789 3:163924240-163924262 CATGTTACCCCAGGAGGAAGAGG - Intergenic
965429834 3:168572827-168572849 CATGTGAACCCAGGAGGCGGTGG + Intergenic
965599865 3:170444142-170444164 CATTTGAGCCCAGAAGGCGGAGG - Intronic
966385413 3:179392311-179392333 TATGTGACCCCTGAGGGGTGGGG + Exonic
966844575 3:184118204-184118226 CATGTGAACCCAGGAGGCGGAGG + Intergenic
967065032 3:185907582-185907604 CAAGTGACCGAAGAGAGAGGAGG + Intergenic
968173215 3:196527054-196527076 CATTTGAACCCAGAAGGCGGAGG + Intergenic
968428315 4:537550-537572 CCGGGGACCCCACAGGGAGGTGG - Intronic
968520536 4:1032915-1032937 CAGGAGACCCCAGAGGCAGACGG - Intergenic
968593169 4:1469765-1469787 CATGTGAAGACAGAGGCAGGTGG - Intergenic
968623808 4:1617051-1617073 CACTTGAACCCAGAGGGCGGAGG + Intergenic
968704425 4:2071433-2071455 CATGTGACCCCAGACGCCCGCGG + Intergenic
968713505 4:2137920-2137942 CATTTGAACCCAGGAGGAGGAGG - Intronic
968868528 4:3228647-3228669 CATCACACCCCTGAGGGAGGAGG + Exonic
969239537 4:5889458-5889480 GATGTTGCTCCAGAGGGAGGTGG + Intronic
969257947 4:6015342-6015364 CATGTGACGACACAGGGAGAAGG + Intergenic
969575419 4:8033629-8033651 CAGGTCTCCCCAGAGGGAGGGGG + Intronic
969924098 4:10569409-10569431 CATGTGAGCACACAGGGAGAGGG + Intronic
970589709 4:17548459-17548481 CATGTGAACCCAGGAGGCGGAGG + Intergenic
971936112 4:33149873-33149895 CATGTGACCCAGGAGGGTGCAGG - Intergenic
972420004 4:38878212-38878234 CAGCTGACCCCAGAGGGGAGGGG + Exonic
976125512 4:81829872-81829894 CCTGAGAACCCAGAGGAAGGGGG + Intronic
976130979 4:81883638-81883660 CATGAGAACCCTGAGGCAGGTGG + Intronic
976607068 4:86993878-86993900 CATGTGAACCCAGGAGGTGGAGG + Intronic
976628660 4:87214880-87214902 CATGTGAACCCAGGAGGAGGAGG - Intronic
976824273 4:89242488-89242510 TATGTGAGCCCAGAGGGAAGAGG - Exonic
978199104 4:106004342-106004364 CATGTGAGGACAGAGGGAGAAGG + Intergenic
978283130 4:107040814-107040836 TATGTGACCATAGATGGAGGTGG + Intronic
982444203 4:155471340-155471362 CACTTGACCCCAGGAGGAGGGGG - Intergenic
982459231 4:155647512-155647534 CATTTGAACCCAGAAGGCGGAGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
985658778 5:1145311-1145333 GCTGTGTCCCCACAGGGAGGGGG - Intergenic
985863343 5:2491937-2491959 CATTTGAACCCAGGAGGAGGAGG + Intergenic
986027151 5:3861611-3861633 CATGTGACCACATAAGAAGGTGG - Intergenic
987337953 5:16913828-16913850 CATGTGGCAAGAGAGGGAGGAGG + Intronic
990208502 5:53455708-53455730 CATGTGACCCAAGAGTAAGGGGG - Intergenic
990218860 5:53564620-53564642 CACCTGAGCCCAGAGGGTGGAGG - Intronic
992705496 5:79387209-79387231 CATGTGAGCCCAGAAGGTTGAGG - Intronic
995803985 5:116030465-116030487 CATGTGAACACAGAGAGAGGAGG + Intronic
997368698 5:133342228-133342250 CATGTGGCTGCAGAGAGAGGCGG + Intronic
999886676 5:155931946-155931968 CATGTGAGCACACAGGGAGAAGG - Intronic
1000284088 5:159811536-159811558 CATGTGAGCACACAGGGAGAAGG + Intergenic
1000802281 5:165743257-165743279 CAGCTGAGCCCAGAAGGAGGAGG - Intergenic
1001051012 5:168414486-168414508 CAAGTGGACCCAGGGGGAGGTGG + Exonic
1001419315 5:171574568-171574590 AATGGGACCCCAGAGGGGGCTGG - Intergenic
1001601247 5:172930102-172930124 CACTTGAACCCAGAGGGTGGAGG + Intronic
1002507926 5:179693060-179693082 CATGTGAACTCGGAGGGTGGTGG + Intronic
1002724321 5:181284175-181284197 CAGGTGACACCACAGGCAGGTGG - Intergenic
1003913134 6:10760726-10760748 CACTTGAACCCAGAAGGAGGAGG - Intronic
1004238149 6:13893895-13893917 CATGTGAGGACAGAGTGAGGGGG + Intergenic
1004565846 6:16796757-16796779 CATTTGAACCCAGAAGGTGGAGG + Intergenic
1004962191 6:20802212-20802234 CATGTGAACCCAGGAGGCGGAGG + Intronic
1005341220 6:24845474-24845496 CATGGCAGCACAGAGGGAGGTGG + Intronic
1005995399 6:30927955-30927977 CATTTCCACCCAGAGGGAGGAGG + Intergenic
1006085994 6:31595626-31595648 CACTTGAACCCAGAGGGCGGAGG - Intergenic
1007018751 6:38497276-38497298 CCTGTGACAGCAGTGGGAGGTGG - Intronic
1008500138 6:52172465-52172487 CATTTGAACCCAGGGGGTGGAGG + Intergenic
1013111298 6:107067477-107067499 CATGTGCCCCCCAAGGCAGGGGG + Exonic
1013112248 6:107073404-107073426 AAGGAGACCCCAGAGGGAGTGGG - Intronic
1013784477 6:113764494-113764516 CATTTGAACCCGGAGGGTGGAGG - Intergenic
1014727965 6:124995836-124995858 CATGTGAACCCAGGAGGTGGAGG + Intronic
1015597245 6:134877530-134877552 CATGTGAACACACAGGGAGAAGG - Intergenic
1015636382 6:135279150-135279172 CATGTGAACCCAGGAGGCGGAGG - Intergenic
1015805769 6:137107044-137107066 CATTTGAACCCAGAAGGTGGAGG - Intergenic
1016699135 6:147034097-147034119 TATGTGTCCCCAGAGAAAGGAGG + Intergenic
1017500734 6:155020543-155020565 CATGTGAACCCAGGGGGCGGAGG - Intronic
1017530139 6:155281636-155281658 CATTTGAACCCAGAAGGTGGAGG + Intronic
1018088403 6:160325021-160325043 GATGTGACCGCAGAGGCAGGAGG - Intergenic
1018677048 6:166231198-166231220 CATTTGAACCCGGAGGGTGGAGG + Intergenic
1019184319 6:170212289-170212311 CCTGTGGCCCCAGTGGAAGGCGG + Intergenic
1019209768 6:170395472-170395494 TATGTGTTCCCACAGGGAGGTGG + Exonic
1019447571 7:1079317-1079339 GAGGTGTCCCCATAGGGAGGTGG - Intronic
1019772067 7:2889970-2889992 CATTTGAACCCAGAAGGTGGAGG - Intergenic
1019791683 7:3018245-3018267 CATTTGAACCCAGAAGGCGGAGG - Intronic
1019857104 7:3620384-3620406 CATTTGAACCCAGAAGGTGGAGG - Intronic
1020081759 7:5289967-5289989 CATTTGACCCCAGGAGGTGGAGG - Intronic
1020118190 7:5488003-5488025 CAGGTGGCCCCAGAGGGCGCTGG - Intronic
1021728818 7:23576710-23576732 CATTTGAACCCAGAAGGTGGAGG - Intergenic
1022194527 7:28051305-28051327 CATGTGAACCCAGGAGGTGGAGG - Intronic
1022624769 7:32023977-32023999 GATGTGAACCCTGAGGGAGCTGG + Intronic
1023937996 7:44753326-44753348 CACTTGACCCCAGAAGGTGGAGG - Intronic
1024002148 7:45197149-45197171 CGCGTGAGCCCAGAGGGTGGAGG + Intergenic
1024199966 7:47096636-47096658 CATGTGAACCCAGGAGGCGGAGG + Intergenic
1024212767 7:47219677-47219699 CACTTGAACCCAGAAGGAGGAGG + Intergenic
1024247805 7:47483662-47483684 CATCTGGCCACAGAGGGATGTGG - Intronic
1024342627 7:48282749-48282771 CATGTGACCCCAGACAGGGTAGG - Intronic
1024345589 7:48310267-48310289 CAGGTGACACCAGAGGCTGGTGG - Intronic
1024521707 7:50310508-50310530 CATGCAAACCCAGGGGGAGGGGG - Intronic
1024618114 7:51132964-51132986 AATGTGATCCCAGTTGGAGGTGG - Intronic
1024758863 7:52569508-52569530 AAAGTGACCCCAAAGGGAAGAGG - Intergenic
1025084755 7:56014043-56014065 CACTTGAGCCCAGAGGGCGGAGG + Intronic
1025144955 7:56494480-56494502 AATGTGACCCCTGAAAGAGGGGG + Intergenic
1025197154 7:56942183-56942205 CATTTGACCCCAGGAGGTGGAGG + Intergenic
1025674794 7:63634756-63634778 CATTTGACCCCAGGAGGTGGAGG - Intergenic
1025791179 7:64688338-64688360 CATTTGAACCCAGAAGGTGGAGG - Intronic
1025795644 7:64737176-64737198 CATTTGAACCCAGAAGGTGGAGG - Intergenic
1027782839 7:82541191-82541213 CATGTGAGCCCTGGAGGAGGAGG - Intergenic
1027794140 7:82671157-82671179 CATATGAGCACAGAGGGAGATGG - Intergenic
1029649680 7:101882805-101882827 CCAGTGACCCCAGAGGGCGCCGG - Intronic
1029727903 7:102419962-102419984 CCTGTGAACCCAGGGGGCGGAGG - Intronic
1032011186 7:128349254-128349276 CCTGGGACCTCAGATGGAGGAGG - Intergenic
1032025001 7:128434242-128434264 CATGTGTCCTCAGAGGGACCTGG - Intergenic
1032101001 7:128977678-128977700 CATTTGAACCCGGAGGGTGGAGG - Intronic
1032103455 7:129003137-129003159 CATTTGAACCCAGAGGGCGAAGG + Intronic
1032132564 7:129242631-129242653 CATGTGAACCCAGGAGGCGGAGG + Intronic
1032157947 7:129485281-129485303 AATGAGGGCCCAGAGGGAGGTGG - Intronic
1032197686 7:129798862-129798884 CATGTGATCCCATAGGCAGTGGG + Intergenic
1033453098 7:141479034-141479056 CATCTGCCCCCAGAGGGTGTCGG + Exonic
1033662384 7:143411026-143411048 CTTGGGACTCCAGAGGGTGGGGG + Intergenic
1035453785 7:158996416-158996438 GATTTGACCCCAGAGGGACTGGG + Intergenic
1036256497 8:7210684-7210706 CATGTGAGCCCTTGGGGAGGTGG + Intergenic
1036308547 8:7669269-7669291 CATGTGAGCCCTTGGGGAGGTGG + Intergenic
1037116663 8:15236777-15236799 CAGGGGACCCCAGAGGGAGAGGG + Intronic
1037959083 8:23083119-23083141 CATGGGACGCCAGATGGAAGTGG - Intergenic
1038648200 8:29378802-29378824 CATTTGAACCCAGAAGGCGGAGG - Intergenic
1039442973 8:37608128-37608150 CATGAGACCCCAGAAGAAGATGG + Intergenic
1039591379 8:38752720-38752742 CCTGTGACACAAGAAGGAGGAGG - Intronic
1040051875 8:43023120-43023142 CATGTGAACCCAGGAGGTGGAGG + Exonic
1040946621 8:52891850-52891872 CATGTGAACACACAGGGAGAAGG + Intergenic
1041259609 8:56009548-56009570 CATGTGAAGACACAGGGAGGAGG - Intronic
1042078645 8:65024569-65024591 CAGGTGGCCCCAGACAGAGGTGG + Intergenic
1042161162 8:65897172-65897194 CATTTGAACCCAGAAGGCGGAGG + Intergenic
1042225314 8:66510725-66510747 CATGTGAACCCACAGTGAGAAGG - Intronic
1042524983 8:69754852-69754874 CATGTGGCCCCAGAGAAGGGTGG - Intronic
1044111846 8:88285221-88285243 CACTTGAACCCAGAGGGCGGAGG - Intronic
1044614719 8:94128007-94128029 CATGTGAACCCAGGAGGCGGAGG + Exonic
1044626603 8:94240319-94240341 CATATGGCCCAAGAGGTAGGGGG + Intergenic
1045249694 8:100473202-100473224 CATGGGACTCCAGTTGGAGGAGG + Intergenic
1045651297 8:104343792-104343814 CATGTGAGGACACAGGGAGGAGG + Intronic
1047191813 8:122685231-122685253 CAGGTGACCCCAGAGATAGTGGG - Intergenic
1047626291 8:126659601-126659623 CATGTGAGGACACAGGGAGGAGG - Intergenic
1048898365 8:139015195-139015217 CATGAGTCCTCAGAGAGAGGGGG + Intergenic
1049064288 8:140300842-140300864 CAGGAGTCCCCAGAGGGAAGTGG - Intronic
1049243239 8:141549223-141549245 CATGTGGCCCCCGAGGGAGCAGG + Intergenic
1049878884 8:145047751-145047773 CACTTGACCTCAGAGGGAGGAGG + Intergenic
1050077406 9:1879426-1879448 CATGTGACTAGAGAGGGAGCTGG - Intergenic
1050085403 9:1959848-1959870 CAGGTGAACCCAGAAGGAGATGG + Intergenic
1050527762 9:6560934-6560956 GATGGGACCACAGAGGGAGCGGG + Intronic
1053056452 9:34995813-34995835 GATGTGACCACAGAGGGGGCTGG - Intronic
1053284637 9:36842286-36842308 CAGGTGAGCCCAGAGGAAGGCGG + Intronic
1055028648 9:71749620-71749642 CATTTGAACCCAGGGGGCGGAGG + Intronic
1055089393 9:72347418-72347440 CCTGTAATCCCAGAGGCAGGTGG + Intergenic
1055445666 9:76379816-76379838 AATGTGAACCATGAGGGAGGAGG + Intergenic
1055589988 9:77802269-77802291 CCTGTGAGCCCAGAGTGAGGGGG - Intronic
1056496207 9:87157877-87157899 CACGTGACCCCTGAGGCATGGGG + Exonic
1056533197 9:87505477-87505499 CACTTGAACCCAGAGGGCGGAGG - Intronic
1056637755 9:88345668-88345690 CACTTGACCCCAGAAGGTGGAGG - Intergenic
1056703510 9:88931914-88931936 CATGTGTGCCCAGAAGCAGGTGG + Intergenic
1057379979 9:94558991-94559013 CTGGTGACCCCAGAATGAGGGGG + Exonic
1057719868 9:97523370-97523392 CATTTCCCCCCAGAGGGAGCCGG - Intronic
1058835104 9:108853726-108853748 CATTTGACCCCAGGAGGCGGAGG - Intergenic
1060104421 9:120864597-120864619 CACTTGAACCCAGTGGGAGGAGG + Intronic
1060218893 9:121754226-121754248 CATCTGGGCCCAGAGGGAGCTGG - Intronic
1060981295 9:127793981-127794003 CACTTGACCCCAGGAGGAGGAGG - Intergenic
1061162693 9:128904432-128904454 CATGTGAACCCAGGAGGCGGAGG + Intronic
1061437485 9:130574363-130574385 CATTTGAACCCAGAAGGAGGAGG + Intergenic
1061584418 9:131556713-131556735 CACTTGAACCCAGAGGGTGGAGG - Intergenic
1061619006 9:131798790-131798812 CAAGTCAGCCCAGAGGGATGAGG - Intergenic
1062145675 9:134988449-134988471 CATCTGCCCCCAGTAGGAGGGGG + Intergenic
1062203392 9:135321189-135321211 CAGGAGACCACAGAGGGTGGGGG + Intergenic
1062321456 9:135992460-135992482 CGGGAGATCCCAGAGGGAGGTGG - Intergenic
1062521316 9:136959131-136959153 CATGTGAGCCCAGAGGCCTGGGG + Intergenic
1062540370 9:137039340-137039362 CTTGCACCCCCAGAGGGAGGAGG - Intergenic
1186426953 X:9469904-9469926 CATGTGTCATCAGAGAGAGGAGG - Intronic
1187573744 X:20532318-20532340 CATGTGAGCCCAGGGGTGGGTGG + Intergenic
1187872836 X:23778541-23778563 CACTTGAACCCAGAGGGCGGAGG + Intergenic
1191821414 X:65312963-65312985 CACTTGAACCCAGAGGGCGGAGG - Intergenic
1192436918 X:71148670-71148692 AGTGTGACCCCCGCGGGAGGAGG - Intronic
1196321065 X:114340952-114340974 CATTTGAGCCCAGGAGGAGGAGG - Intergenic
1197740691 X:129890970-129890992 CATGTGAACCCAGGAGGTGGAGG + Intergenic
1197873852 X:131084045-131084067 CCTGTGCCCTCAGAGGCAGGGGG + Intronic
1198743253 X:139863447-139863469 CACTTGAACCCAGGGGGAGGAGG + Intronic
1200078315 X:153562923-153562945 CATGTGAGCACAGAGTGAGGAGG - Intronic
1200448383 Y:3293631-3293653 CATGTGACCCTAGTGGCTGGGGG + Intergenic
1200761692 Y:7044727-7044749 CATGTGACCCCAGGAGGCGGAGG - Intronic
1202039953 Y:20671768-20671790 CATGTGAACCCAGGAGGAGGAGG - Intergenic
1202102894 Y:21329303-21329325 CATTTGAACCCAGAAGGTGGAGG + Intergenic