ID: 1165957081

View in Genome Browser
Species Human (GRCh38)
Location 19:39507668-39507690
Sequence GCCAACTGCACCACGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165957081_1165957086 2 Left 1165957081 19:39507668-39507690 CCCATCTCCGTGGTGCAGTTGGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1165957086 19:39507693-39507715 GATTCCTTGATGCATTTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 151
1165957081_1165957091 21 Left 1165957081 19:39507668-39507690 CCCATCTCCGTGGTGCAGTTGGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1165957091 19:39507712-39507734 CTGGTCGGTCTCTCTTACCCCGG 0: 1
1: 0
2: 3
3: 8
4: 124
1165957081_1165957088 6 Left 1165957081 19:39507668-39507690 CCCATCTCCGTGGTGCAGTTGGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1165957088 19:39507697-39507719 CCTTGATGCATTTCCCTGGTCGG 0: 1
1: 0
2: 0
3: 11
4: 148
1165957081_1165957092 28 Left 1165957081 19:39507668-39507690 CCCATCTCCGTGGTGCAGTTGGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1165957092 19:39507719-39507741 GTCTCTCTTACCCCGGTAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165957081 Original CRISPR GCCAACTGCACCACGGAGAT GGG (reversed) Intronic
900513954 1:3072651-3072673 GCCAACTGCCCCAGGGAGGGTGG - Intronic
903845771 1:26279308-26279330 GCCATCTGCAGCATGGAGCTGGG + Exonic
909106876 1:71422265-71422287 GCCAGCTGCATCAAAGAGATGGG - Intronic
914959567 1:152194524-152194546 GCCAACTGCACCAAAGAGGAAGG - Intergenic
1070867085 10:79713091-79713113 GCCACCTGCAACATGGACATGGG + Intronic
1070880875 10:79851212-79851234 GCCACCTGCAACATGGACATGGG + Intergenic
1075133370 10:119759961-119759983 ACCATCTGCACCAAGGAGACGGG - Intronic
1076214501 10:128682097-128682119 GCCCACGGCTCCACTGAGATTGG - Intergenic
1077130161 11:968044-968066 GCCACCTGCCCCACCGAGATGGG + Intronic
1078065025 11:8072597-8072619 GTCCAAAGCACCACGGAGATGGG - Intronic
1078962427 11:16293236-16293258 GCCAACTACATCATGGGGATAGG - Intronic
1086886402 11:92210872-92210894 GCCAACTGAAGCCCAGAGATGGG - Intergenic
1092525253 12:9305869-9305891 GCCCACTGCACCAAGGAGGGTGG - Intergenic
1092542019 12:9425948-9425970 GCCCACTGCACCAAGGAGGGTGG + Intergenic
1094510991 12:31096491-31096513 GCCCACTGCACCAAGGAGAGTGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1098033857 12:66282276-66282298 GCCAACTGGATAACGGGGATAGG - Intergenic
1103398931 12:120629161-120629183 GCCAAGGGCAGCACGGAGAAGGG + Intergenic
1103507778 12:121453286-121453308 GCCAACTTCACCGCGGAGGCCGG + Exonic
1105423276 13:20272033-20272055 GCCATCTCCAGCACAGAGATGGG - Intergenic
1115906815 14:38210245-38210267 ACCAGCTGCACCACGTAGAAAGG - Exonic
1117090864 14:52248581-52248603 GCCACCTGCACCACAGACAAGGG + Intergenic
1118761139 14:68880805-68880827 ACCAACTACACCATGGAGGTGGG - Exonic
1122123226 14:99565655-99565677 TCCACCTGCACCAGGGAGAGAGG - Intronic
1128602559 15:69010124-69010146 GCCAACTGCTCCTTGGTGATTGG - Intronic
1137497302 16:48980501-48980523 CCTCACTGCACCACTGAGATAGG + Intergenic
1153475003 18:5489349-5489371 GTCAACTTCACCACTGAGATGGG + Intronic
1162534162 19:11253352-11253374 GCCACCTGGACCACCTAGATGGG - Intronic
1165957081 19:39507668-39507690 GCCAACTGCACCACGGAGATGGG - Intronic
1166074938 19:40408470-40408492 CCCACCTGCACGACGGGGATAGG - Intronic
1168267587 19:55230988-55231010 GCCACCTGCCCCACGGGGAGGGG + Intronic
925390898 2:3493223-3493245 GCCAACTTCACCACAGAACTAGG + Intergenic
926764410 2:16311676-16311698 TCCCACTGCACCACGGTGAGGGG + Intergenic
941345024 2:164357633-164357655 TCAAATTGCAACACGGAGATAGG + Intergenic
948779057 2:240305997-240306019 GCCAATTGCACCACCGGGCTGGG - Intergenic
1170269434 20:14507768-14507790 GCAAACTGTATCACGGACATGGG - Intronic
1171192067 20:23165810-23165832 GCCATCTCCTCCACGGAGAGTGG + Intergenic
1177113620 21:17058954-17058976 GCCCACTGCCCCAAGGAGAATGG + Intergenic
1180317174 22:11285333-11285355 GCCCACAGCACCAAGGAGACAGG - Intergenic
1183706630 22:39478504-39478526 GCCGTCTGAACCACGGAGGTGGG + Intronic
949300484 3:2577879-2577901 GTAAACTGCACCACAGAGATGGG - Intronic
950567164 3:13776736-13776758 GCCAGCTGCTTCAGGGAGATGGG - Intergenic
950584048 3:13880265-13880287 GCCACCTGCACCCCGGAGCAGGG - Intergenic
952241490 3:31534197-31534219 GCAAACAGTACCACGGTGATGGG + Intronic
955818350 3:62871585-62871607 GCCTAAAGCACCACGTAGATGGG - Intronic
958885412 3:99721145-99721167 GCCAACTCCAGCACGAAGTTGGG + Intronic
962922237 3:139960670-139960692 GCGTGCTGCACCATGGAGATAGG + Intronic
976496766 4:85739200-85739222 GCCTACTGCACCAGGGAGGCAGG - Intronic
982101340 4:151971301-151971323 GCCAATTGCCCCAAGGGGATAGG + Intergenic
984164370 4:176289563-176289585 GCCGACTGCACCACGGTAAATGG + Intergenic
986302339 5:6487878-6487900 GCCCACTGCACCAAGAAGAGGGG - Intronic
993209720 5:84933071-84933093 TCCAACTGCACCACCCATATTGG + Intergenic
998648408 5:144090220-144090242 GCGGACTGCCCCATGGAGATGGG - Intergenic
1005636363 6:27757318-27757340 GGCCACTGCGCCACGCAGATTGG - Intergenic
1006928926 6:37675824-37675846 GCCAAGTGAACCACAGTGATGGG - Intronic
1018467392 6:164062152-164062174 GCCAGCTGGCCCACTGAGATGGG + Intergenic
1024529880 7:50382893-50382915 TCCCACTGCACCAGGGAGATTGG + Intronic
1028505558 7:91566610-91566632 GCCATCTGCACCCAGGAGAAAGG + Intergenic
1029283138 7:99449550-99449572 GTCACCTGCACCACAGACATTGG + Intronic
1033480987 7:141740251-141740273 GCCAACAGCACCCTGGGGATTGG + Intronic
1034947855 7:155275323-155275345 GCCAACTGGACCACAGGAATGGG - Intergenic
1035642117 8:1191872-1191894 GCCAACTGCACCAAGAATAAAGG - Intergenic
1037595515 8:20351000-20351022 ACCTACTGGACCAGGGAGATCGG - Intergenic
1048026781 8:130594501-130594523 GGCAAATGCACCAAGGAGAAGGG + Intergenic
1057954877 9:99399604-99399626 GCCAACTGCAGAACGGAGAGTGG - Intergenic
1185522510 X:752048-752070 GACAATTGCCCCACGGAGCTGGG + Intergenic
1187159039 X:16747381-16747403 GGCATCTGCACCCCGGAGCTTGG - Intronic
1201054444 Y:9974969-9974991 GCCAACTGCAACAATAAGATAGG - Intergenic
1201762926 Y:17558557-17558579 GCCCACTGCACCAAGAAGATAGG + Intergenic
1201838626 Y:18347432-18347454 GCCCACTGCACCAAGAAGATAGG - Intergenic