ID: 1165957082

View in Genome Browser
Species Human (GRCh38)
Location 19:39507669-39507691
Sequence GGCCAACTGCACCACGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165957082_1165957092 27 Left 1165957082 19:39507669-39507691 CCATCTCCGTGGTGCAGTTGGCC 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1165957092 19:39507719-39507741 GTCTCTCTTACCCCGGTAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 54
1165957082_1165957091 20 Left 1165957082 19:39507669-39507691 CCATCTCCGTGGTGCAGTTGGCC 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1165957091 19:39507712-39507734 CTGGTCGGTCTCTCTTACCCCGG 0: 1
1: 0
2: 3
3: 8
4: 124
1165957082_1165957086 1 Left 1165957082 19:39507669-39507691 CCATCTCCGTGGTGCAGTTGGCC 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1165957086 19:39507693-39507715 GATTCCTTGATGCATTTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 151
1165957082_1165957088 5 Left 1165957082 19:39507669-39507691 CCATCTCCGTGGTGCAGTTGGCC 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1165957088 19:39507697-39507719 CCTTGATGCATTTCCCTGGTCGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165957082 Original CRISPR GGCCAACTGCACCACGGAGA TGG (reversed) Intronic
900975638 1:6014597-6014619 GGCAAGCAGCACCACAGAGAGGG + Intronic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
904014559 1:27409794-27409816 GGCCATCTGCACCAGTGAAAGGG + Exonic
904365817 1:30010381-30010403 GGCCTCCTGCTCCACGGAGCAGG - Intergenic
905584432 1:39105653-39105675 GGCCAACCGCAGCCAGGAGAAGG + Intronic
907047434 1:51308049-51308071 GTCCACATGCACCACAGAGAAGG - Intronic
907064121 1:51462553-51462575 GTCCACATGCACCACAGAGAAGG + Intronic
908450761 1:64252285-64252307 AGTCAACTGAACCACAGAGATGG - Intronic
912009768 1:104945528-104945550 GGCTGACTGCCCCACGGGGATGG - Intergenic
912179878 1:107206903-107206925 ATCCAACTGCACCAGCGAGATGG - Intronic
918276652 1:182959361-182959383 GGCCCACTGCACCCTGCAGATGG - Intergenic
918887307 1:190211691-190211713 GGCCAACTGGAACAGGGAGAAGG + Intronic
921990158 1:221357317-221357339 GGCAAACTACACCACCAAGAAGG - Intergenic
921997528 1:221437447-221437469 GGCAAACTACACCACCAAGAAGG + Intergenic
1064075563 10:12265910-12265932 GGCTCACTTCCCCACGGAGATGG - Intergenic
1068492254 10:57738342-57738364 GTCCAACTGCTCCACATAGAAGG + Intergenic
1069948389 10:72002731-72002753 GGCCACCTGCCCCACTGACAGGG - Intronic
1071918550 10:90324235-90324257 GGGAAACTGCGCCACAGAGAGGG + Intergenic
1075133371 10:119759962-119759984 AACCATCTGCACCAAGGAGACGG - Intronic
1076585014 10:131541092-131541114 GGCTCACTGCACCACAGATATGG - Intergenic
1076613020 10:131738074-131738096 GGCCGGCTGCCCCATGGAGAGGG + Intergenic
1077121127 11:909083-909105 AGACAACTGCCCCAGGGAGATGG + Intronic
1077130160 11:968043-968065 TGCCACCTGCCCCACCGAGATGG + Intronic
1077606652 11:3616929-3616951 GGCCAACAGCACATCGGTGAGGG - Intergenic
1081106669 11:39078768-39078790 GGCCAACAACCCCACGAAGAGGG - Intergenic
1081137959 11:39462535-39462557 GCCCAATTGCACCACAGAGGTGG + Intergenic
1082775805 11:57243630-57243652 GGGAAACTGCCCCACAGAGAGGG - Intergenic
1083258526 11:61510664-61510686 GGCCTCCTGCACCGCAGAGAGGG + Exonic
1084266716 11:68008784-68008806 GGCCCAGGGCACCAGGGAGATGG + Intronic
1084891117 11:72237603-72237625 GGCCATCTGCAGCACCGAGCAGG - Exonic
1088811154 11:113393598-113393620 GGCCAACGGCTCCCTGGAGAAGG + Exonic
1090404948 11:126470806-126470828 TGCCCACTCCACCACTGAGAAGG + Intronic
1090627350 11:128618543-128618565 GGCCATATGCACCACTGGGACGG - Intergenic
1094297814 12:28927708-28927730 GGGCAGCTGCAACAAGGAGATGG + Intergenic
1097455285 12:59792521-59792543 AGTCAACTGAACCACAGAGATGG + Intergenic
1100716004 12:97306407-97306429 GGCCAACTGCTCCACGTTGCAGG - Intergenic
1103321956 12:120097349-120097371 GTTCAACTGCATCACGGAGCTGG - Exonic
1103398930 12:120629160-120629182 GGCCAAGGGCAGCACGGAGAAGG + Intergenic
1105730644 13:23211979-23212001 GGACAACAGCACCAAGGGGATGG - Intronic
1105851318 13:24339052-24339074 GGCCAACGACACCGCGAAGAGGG - Intergenic
1106387594 13:29302688-29302710 AGTCAACTGAACCACAGAGATGG - Intronic
1113650932 13:112033763-112033785 GACCACCTGCAGCAAGGAGATGG + Intergenic
1115951521 14:38727295-38727317 GGCCACGTGCACCCAGGAGAAGG + Intergenic
1117090863 14:52248580-52248602 AGCCACCTGCACCACAGACAAGG + Intergenic
1117149460 14:52870918-52870940 GGACAACAGCACCAGGGAAAAGG - Intronic
1121400807 14:93675301-93675323 GGCTAACTGAACCTAGGAGACGG + Intronic
1122671046 14:103372687-103372709 GGCCAGCAGCCCCACGGGGAAGG + Intergenic
1128651234 15:69414834-69414856 GGCCAACTGCACTCTGGAGGCGG - Intronic
1131185614 15:90271511-90271533 GGACAAATACACCAAGGAGAAGG + Exonic
1131590923 15:93747238-93747260 AGTCAACTGAACCACAGAGATGG - Intergenic
1132107626 15:99074688-99074710 TGCCAAGTGGACAACGGAGATGG + Intergenic
1132751662 16:1460472-1460494 GGCCCACAGCAACAGGGAGAAGG + Exonic
1133971263 16:10569907-10569929 AGCCAACTGCAGGAGGGAGAGGG + Intronic
1136403035 16:30028814-30028836 GGCCGTCAGCACCACGGACAGGG + Intronic
1143657817 17:8306891-8306913 GGACAACTCAAGCACGGAGAGGG - Intergenic
1148469655 17:47885209-47885231 GGCTTGCAGCACCACGGAGAGGG + Intergenic
1148567041 17:48639481-48639503 GGCCATCTGCACCATGGAGTTGG - Intergenic
1149356507 17:55845373-55845395 GCCTGGCTGCACCACGGAGACGG - Intergenic
1152260244 17:79262898-79262920 GGCCACCTGAAACAAGGAGAAGG - Intronic
1153475002 18:5489348-5489370 TGTCAACTTCACCACTGAGATGG + Intronic
1156298935 18:35818278-35818300 GGCCTCCTGCAACACGGAGTGGG - Intergenic
1157097151 18:44696357-44696379 GGCCATCAGAACCACTGAGAGGG + Intronic
1157291893 18:46415581-46415603 GGCCTAGTGCACCAGGGAGGGGG - Intronic
1157701098 18:49761971-49761993 GGCCCAGTGGCCCACGGAGAAGG + Intergenic
1160232544 18:77058788-77058810 GGCCGACTGCAGCCTGGAGAAGG + Intronic
1160976799 19:1796738-1796760 GGCCATCTGCCACACGGTGATGG - Exonic
1161925024 19:7293791-7293813 GGCCACCTGTACCCCGGAGAGGG - Exonic
1165285177 19:34835866-34835888 GACAAACTGCTCCAGGGAGAGGG - Intergenic
1165957082 19:39507669-39507691 GGCCAACTGCACCACGGAGATGG - Intronic
1168267586 19:55230987-55231009 TGCCACCTGCCCCACGGGGAGGG + Intronic
926050217 2:9739880-9739902 GGCCATCGGCATCACTGAGAAGG + Intergenic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
927880758 2:26688402-26688424 GGCCAACTGGACCAAATAGAGGG + Intergenic
928134583 2:28678660-28678682 GGCCCACAGCACCAAGGACACGG + Intergenic
928211733 2:29328650-29328672 GGCCAACATCAGCAGGGAGAGGG + Intronic
931093076 2:58908011-58908033 GCTCAACTGCACCAGGAAGATGG + Intergenic
932075051 2:68654985-68655007 CGCCTACTTCACCACCGAGACGG + Exonic
935757853 2:106290766-106290788 AGCCAACTGCAGCACGGTCATGG - Intergenic
936041362 2:109152334-109152356 TGCCAAATGCACCAGGGAAAGGG - Intronic
936089309 2:109490718-109490740 GGCCCACTGCACCTTGGAGCAGG - Exonic
948557645 2:238824662-238824684 GTACATCTGCACCACAGAGAAGG - Intergenic
948867993 2:240784988-240785010 GACCAATATCACCACGGAGAAGG - Exonic
1175251213 20:57611129-57611151 GGCCAACTGGAGCAGGGTGATGG - Intronic
1175776133 20:61654861-61654883 GGCCAGCTGCTCCTCTGAGACGG + Intronic
1183165023 22:36141010-36141032 TGGCAAGTGCACCAAGGAGAAGG - Exonic
1183176280 22:36226895-36226917 TGGCAAGTGCACCAAGGAGAAGG - Exonic
1183651018 22:39153156-39153178 GCCAAACTGCGCCGCGGAGAAGG - Intergenic
1184363417 22:44032512-44032534 GGCGGACTGCACCACCGCGACGG - Intronic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
949300485 3:2577880-2577902 GGTAAACTGCACCACAGAGATGG - Intronic
950567165 3:13776737-13776759 GGCCAGCTGCTTCAGGGAGATGG - Intergenic
950584049 3:13880266-13880288 TGCCACCTGCACCCCGGAGCAGG - Intergenic
950944618 3:16932014-16932036 GGCCATCTGCAGCCTGGAGAGGG + Intronic
952269481 3:31817496-31817518 GGCCTCCTGCTCCACGGAGCAGG - Intronic
953909563 3:46884789-46884811 GGGCAACTGAGGCACGGAGAAGG - Intronic
954710880 3:52504556-52504578 GGCCAGCTCCACCATGGGGAGGG - Intronic
957966080 3:87323522-87323544 GGCCATGTGCACCCAGGAGAAGG + Intergenic
962712911 3:138102641-138102663 GGCCATGTGCACCCAGGAGAAGG - Intronic
967436885 3:189457546-189457568 GGTCAACTCCACCGCAGAGAGGG + Intergenic
968736340 4:2298697-2298719 GCCCGACTGCACGACGGAGCAGG + Intronic
970986003 4:22158913-22158935 GGCCAAATGCACCACATAAAAGG - Intergenic
971271991 4:25158794-25158816 AGCCAAATGCAACAGGGAGATGG - Intronic
971545730 4:27883067-27883089 GGTGAACTGCTCCACGCAGAAGG + Intergenic
971947577 4:33301065-33301087 GGCCAATTGCTCCACAGAAAAGG + Intergenic
975859191 4:78658202-78658224 GGCCAAATGCAATACAGAGAGGG + Intergenic
981469046 4:145108664-145108686 GGCCTACTGCAGCAGGGAGAAGG + Intronic
985127241 4:186706913-186706935 AGCCTTCTGGACCACGGAGAAGG - Exonic
986302340 5:6487879-6487901 TGCCCACTGCACCAAGAAGAGGG - Intronic
986820909 5:11465886-11465908 GGCCATCTGCACCTTGGAGATGG - Intronic
995689378 5:114806498-114806520 GGCAAAATGCACCACATAGAAGG + Intergenic
998792191 5:145777716-145777738 GGCCTCCTGCTCCACGGAGCAGG + Intronic
1001476515 5:172054689-172054711 GGAGAACTGCACCAGAGAGAGGG + Exonic
1005315345 6:24598287-24598309 GGCCATGTGCACCCAGGAGAAGG + Intronic
1008617409 6:53239907-53239929 GGCCAGCTGCACTAGCGAGAAGG - Intergenic
1011467319 6:87671630-87671652 GGCCAACAGCAAGACAGAGAAGG + Intergenic
1012418888 6:99039944-99039966 GGGCTACTGAACCACAGAGATGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019285035 7:219145-219167 GGCTTCCTGCATCACGGAGAAGG - Intronic
1019688172 7:2394102-2394124 GGACAAATACACCAAGGAGATGG - Intergenic
1022577991 7:31517522-31517544 GGCCAACGACCCCACGAAGAGGG + Intronic
1022822789 7:33977529-33977551 GGCCAAATGCTCCACTGAGGAGG + Intronic
1029177374 7:98674638-98674660 TGCCAGCTCCACCAGGGAGAGGG - Intergenic
1034947856 7:155275324-155275346 GGCCAACTGGACCACAGGAATGG - Intergenic
1037503259 8:19505672-19505694 GGCCAACAGCCCCACGGGGAAGG - Exonic
1039971450 8:42324703-42324725 GGCCAACCTCAGCACTGAGAAGG + Intronic
1048026780 8:130594500-130594522 GGGCAAATGCACCAAGGAGAAGG + Intergenic
1049381485 8:142318568-142318590 GGCCATCTGCTTCACGGAGCTGG + Exonic
1049671384 8:143871628-143871650 GGCCAGCTTCTCCACGGAGAGGG + Exonic
1049725441 8:144143533-144143555 GGCCAAGTACACCTTGGAGAAGG + Intergenic
1056965339 9:91160111-91160133 GGCCAGCAGCACCCTGGAGAGGG - Intergenic
1059076351 9:111197435-111197457 AGTCAACTGAACCACAGAGATGG - Intergenic
1059247554 9:112861681-112861703 GGCCCACAGCGGCACGGAGAGGG - Intronic
1186368971 X:8927209-8927231 GCCCAACTGAAACAGGGAGAGGG - Intergenic
1188078244 X:25805847-25805869 GGCCAACAACCCCACGAAGAGGG + Intergenic
1189339235 X:40192033-40192055 GGCCAACTGCCTCAGGGAGAGGG - Intergenic
1190136604 X:47804507-47804529 GGCCATCTGCACCAGTGAAAGGG - Intergenic
1194750973 X:97683429-97683451 GGCCAACTGCATCTTGAAGAGGG + Intergenic
1198937793 X:141916913-141916935 GGCCAACTGCCCCTGGGAAACGG + Intergenic
1198961258 X:142185951-142185973 GGCCAACTGCCCCTGGGAAACGG - Intergenic
1199360154 X:146907721-146907743 GGCCTCCTGCTCCACAGAGAAGG - Intergenic
1199981194 X:152921392-152921414 TGCCAACTGCCCCAGGCAGAGGG + Intronic
1200097890 X:153672670-153672692 GGCCAGCACCACCTCGGAGAAGG + Exonic