ID: 1165960175

View in Genome Browser
Species Human (GRCh38)
Location 19:39527549-39527571
Sequence TAACATATGAATATACTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165960172_1165960175 6 Left 1165960172 19:39527520-39527542 CCATTACTACAAAACCTATGAAC No data
Right 1165960175 19:39527549-39527571 TAACATATGAATATACTGCCGGG No data
1165960173_1165960175 -8 Left 1165960173 19:39527534-39527556 CCTATGAACATGATTTAACATAT No data
Right 1165960175 19:39527549-39527571 TAACATATGAATATACTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165960175 Original CRISPR TAACATATGAATATACTGCC GGG Intergenic
No off target data available for this crispr