ID: 1165964329

View in Genome Browser
Species Human (GRCh38)
Location 19:39562852-39562874
Sequence CAGAGGTGCCACCTGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165964324_1165964329 -3 Left 1165964324 19:39562832-39562854 CCCTAGGCCTTGGGTGGGTCCAG No data
Right 1165964329 19:39562852-39562874 CAGAGGTGCCACCTGAAAGTTGG No data
1165964327_1165964329 -10 Left 1165964327 19:39562839-39562861 CCTTGGGTGGGTCCAGAGGTGCC No data
Right 1165964329 19:39562852-39562874 CAGAGGTGCCACCTGAAAGTTGG No data
1165964325_1165964329 -4 Left 1165964325 19:39562833-39562855 CCTAGGCCTTGGGTGGGTCCAGA No data
Right 1165964329 19:39562852-39562874 CAGAGGTGCCACCTGAAAGTTGG No data
1165964317_1165964329 16 Left 1165964317 19:39562813-39562835 CCTTCAGGGCGGTGAGTTCCCCT No data
Right 1165964329 19:39562852-39562874 CAGAGGTGCCACCTGAAAGTTGG No data
1165964323_1165964329 -2 Left 1165964323 19:39562831-39562853 CCCCTAGGCCTTGGGTGGGTCCA No data
Right 1165964329 19:39562852-39562874 CAGAGGTGCCACCTGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165964329 Original CRISPR CAGAGGTGCCACCTGAAAGT TGG Intergenic
No off target data available for this crispr