ID: 1165971039

View in Genome Browser
Species Human (GRCh38)
Location 19:39629956-39629978
Sequence GAAGCAACCTCAACCCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165971039_1165971043 15 Left 1165971039 19:39629956-39629978 CCAGACAGGGTTGAGGTTGCTTC No data
Right 1165971043 19:39629994-39630016 CATTTCTTTTAAAAATGCCCTGG No data
1165971039_1165971040 -9 Left 1165971039 19:39629956-39629978 CCAGACAGGGTTGAGGTTGCTTC No data
Right 1165971040 19:39629970-39629992 GGTTGCTTCATCTTGCTGCCTGG No data
1165971039_1165971041 -8 Left 1165971039 19:39629956-39629978 CCAGACAGGGTTGAGGTTGCTTC No data
Right 1165971041 19:39629971-39629993 GTTGCTTCATCTTGCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165971039 Original CRISPR GAAGCAACCTCAACCCTGTC TGG (reversed) Intergenic
No off target data available for this crispr