ID: 1165974758

View in Genome Browser
Species Human (GRCh38)
Location 19:39665982-39666004
Sequence ATGTGGAAGGGAAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165974758_1165974763 -9 Left 1165974758 19:39665982-39666004 CCTTCCACATTTCCCTTCCACAT No data
Right 1165974763 19:39665996-39666018 CTTCCACATGGCCCTAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165974758 Original CRISPR ATGTGGAAGGGAAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr