ID: 1165982184

View in Genome Browser
Species Human (GRCh38)
Location 19:39734241-39734263
Sequence ATCCCATGGAAGCCGGGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165982178_1165982184 -9 Left 1165982178 19:39734227-39734249 CCTCCTGCTCTGAGATCCCATGG 0: 1
1: 1
2: 2
3: 32
4: 341
Right 1165982184 19:39734241-39734263 ATCCCATGGAAGCCGGGTGCGGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165982184 Original CRISPR ATCCCATGGAAGCCGGGTGC GGG Intronic
900388031 1:2419518-2419540 CTCCCATGGCAGTGGGGTGCAGG + Intergenic
900533118 1:3164506-3164528 AGCCAAGGGAGGCCGGGTGCAGG - Intronic
901271420 1:7954582-7954604 ATCCCATAAAGGCCGGGTTCAGG - Intronic
906098671 1:43241710-43241732 ATCTCTTGGAAGCCCAGTGCAGG + Intronic
916074539 1:161192890-161192912 AGCCCATGGAAGAGGGGTGAAGG + Intronic
918309569 1:183276054-183276076 ATCCCCTGGAAGCCAGGGACGGG - Intronic
920187809 1:204172564-204172586 ATCCTCTGGAAGCAGGGAGCTGG + Intergenic
1063933871 10:11057179-11057201 ATCTCATGGAAGTCGGGTCTGGG - Intronic
1067328607 10:45293268-45293290 ATCCCAGGGAAGCTGAGTGGAGG + Intergenic
1068682598 10:59836354-59836376 AACCCTGGGAAGCCTGGTGCAGG + Intronic
1070540494 10:77412162-77412184 ATCCCATGGTTCCAGGGTGCTGG - Intronic
1073114440 10:101083343-101083365 CTCCCTAGGAAGCCGGATGCTGG - Intergenic
1074549637 10:114430459-114430481 CTCCCCTGGAAGCGGGATGCAGG - Intergenic
1074766019 10:116700638-116700660 ATACCAGGGAAGTGGGGTGCTGG - Intronic
1077211996 11:1375409-1375431 ATCCCCTGGACTCAGGGTGCGGG - Intergenic
1079725067 11:23870351-23870373 AGCCCAGGGAAGCTGGGAGCGGG + Intergenic
1083331911 11:61902660-61902682 TTCCTTTGGAAGCCGGGTGGGGG - Intronic
1083621167 11:64050120-64050142 CCCACAGGGAAGCCGGGTGCAGG + Intronic
1084476824 11:69394079-69394101 CTCCCTCGGAAGCCGGCTGCTGG + Intergenic
1085815249 11:79730573-79730595 ATACTATGGAAGCAGGGGGCAGG - Intergenic
1088343660 11:108797921-108797943 ATCCCAAGGGAGCAGAGTGCAGG + Intronic
1088826323 11:113497169-113497191 TTCTCATGGATGCTGGGTGCTGG - Intergenic
1088982875 11:114879423-114879445 ATCCCATGGAAGAGGGGAGAGGG + Intergenic
1091264047 11:134256537-134256559 GTCCCATGGAAGCTGTGGGCAGG - Exonic
1092071308 12:5633672-5633694 ATGCCAGGGGAGCCCGGTGCCGG - Intronic
1092938243 12:13383916-13383938 AGGCCAGGGAAGCGGGGTGCAGG - Intronic
1094013112 12:25829945-25829967 ACCCCATAGAAGCTGGGTGCAGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1106242512 13:27922363-27922385 TTCCCCTGGAAGCCGTCTGCGGG + Intronic
1107017482 13:35719406-35719428 ATCCCAGGGAAGCTGGCTGAGGG + Intergenic
1113298518 13:108988864-108988886 CTCCCCTGAAGGCCGGGTGCTGG - Intronic
1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG + Intronic
1121215976 14:92248172-92248194 AGCCCATGGAAGCCAGCGGCCGG - Intergenic
1129240039 15:74245624-74245646 TTCCCATGGCAACCGGGTGATGG - Intronic
1132353176 15:101153176-101153198 AGCCCCTGGCAGCCGGGTCCCGG + Intergenic
1132765764 16:1533460-1533482 AGGCCAGGGATGCCGGGTGCGGG - Intronic
1134435578 16:14253424-14253446 ACCCCATGGAACACGGGAGCGGG - Intronic
1138336094 16:56253749-56253771 ATCACATGGAAGCAGAGTGGGGG + Intronic
1143723357 17:8828798-8828820 ATCTCAGGGCTGCCGGGTGCAGG + Exonic
1146593858 17:34153027-34153049 GTCCCAGGGAAGCCAGGTGTGGG - Intronic
1148667166 17:49383359-49383381 TTCCCATGGAAACTGGGTGGTGG - Intronic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1157412899 18:47478670-47478692 AGCAAATGGCAGCCGGGTGCTGG - Intergenic
1159080091 18:63726848-63726870 ATCCCATGGAAGCATGGTTCTGG + Intergenic
1160174265 18:76579905-76579927 TTCCAATGGAAGCCAGGTCCCGG - Intergenic
1164889189 19:31808457-31808479 ATCACAGGGAATCCTGGTGCTGG - Intergenic
1165976688 19:39682228-39682250 AGCCCATGGAGGGTGGGTGCTGG - Intergenic
1165982184 19:39734241-39734263 ATCCCATGGAAGCCGGGTGCGGG + Intronic
1166020490 19:40024477-40024499 AAGGCATGGAAGCCTGGTGCTGG + Intergenic
1167487806 19:49773316-49773338 AGCCAATGGGAGCGGGGTGCTGG + Intronic
925265971 2:2566661-2566683 TTCCCAGGGAAGCCTGGTGCTGG - Intergenic
925307819 2:2862481-2862503 ATCCCATGGGCCCTGGGTGCAGG - Intergenic
925307833 2:2862526-2862548 ATCCCATGGGCCCTGGGTGCAGG - Intergenic
925753406 2:7110046-7110068 ATCCTCTGGAAGCTGGGAGCCGG - Intergenic
927304253 2:21552456-21552478 ATCCTATGCAAGCCTGGTCCAGG - Intergenic
928601140 2:32904611-32904633 ATCCCATGCAAGCCAGTTGTGGG + Intergenic
929659947 2:43774153-43774175 TTCCCACGCAAGCCGGGTTCAGG - Intronic
939266431 2:139879461-139879483 CTCCCATGGAATCCAGGAGCTGG + Intergenic
943324957 2:186486512-186486534 CTCCCAGGGAAGCCCGGAGCGGG - Intronic
948050645 2:234977029-234977051 CTCACAGGGAAGCCGGGTGGCGG + Intronic
1168840923 20:909778-909800 ATCCCACAGAAGCCGAGTGTAGG - Intronic
1175625189 20:60483880-60483902 ATCCCTTGGGAGCTGGGAGCAGG + Intergenic
1176089292 20:63311867-63311889 CTGCCATGGAGGCCGCGTGCTGG + Intronic
1182780164 22:32861276-32861298 ATCCCAAGGAAACCCGATGCCGG - Exonic
1183000545 22:34855195-34855217 CTCCCCTGGATGCCAGGTGCTGG + Intergenic
956161332 3:66356593-66356615 ATACTATGGAAGCTGGGTGAAGG + Intronic
961509382 3:127391699-127391721 GCCCCATGGAAGCCTGGTGTCGG - Intergenic
961613553 3:128160604-128160626 CTCCCAGGGATGCCAGGTGCAGG - Intronic
965559744 3:170049840-170049862 AGCCACTGGAAGACGGGTGCCGG - Intronic
968621530 4:1605434-1605456 AGCCCCTGGAAGCTGGGTGCAGG - Intergenic
968661995 4:1802477-1802499 TTCCCATGGCTGCCGGGTGGGGG + Intronic
969674857 4:8608836-8608858 AGCCCCAGGGAGCCGGGTGCAGG + Intronic
976099948 4:81550789-81550811 ATCCCATGGAAGCAGAGGGGTGG + Intronic
980075478 4:128288556-128288578 ATGCCAGAGAAGCCCGGTGCGGG - Exonic
986306102 5:6518203-6518225 AACCCCTGGAAGCCAGGGGCAGG + Intergenic
1006150313 6:31983508-31983530 TTCCCAGGGAAGCAGGCTGCTGG + Intronic
1006156614 6:32016246-32016268 TTCCCAGGGAAGCAGGCTGCTGG + Intronic
1006630864 6:35428596-35428618 AACCCATGGCTGCCGGGGGCTGG - Intergenic
1006787758 6:36679594-36679616 TTCCCAAGGAAGCCGGGCACTGG + Intronic
1007225095 6:40308280-40308302 ATCCCCTGGAAGCTGGCTACAGG - Intergenic
1008286791 6:49662784-49662806 ATCCCATGGAAGCAGGCTGCTGG + Intergenic
1013427952 6:110032338-110032360 ATCCCATTGTAGCTGGGTGGAGG + Intergenic
1014632310 6:123803076-123803098 AGCCCAGGGGAGCCAGGTGCTGG + Intergenic
1019014760 6:168871835-168871857 ATCTCAAGAAAGCCGGGTTCTGG - Intergenic
1019322691 7:422821-422843 ATCGGATGGAACCCGGGTGTTGG + Intergenic
1024691320 7:51806110-51806132 AGCCCACGGAGGCCGGGTGGCGG - Intergenic
1026574460 7:71560611-71560633 ATCACATGCAACCTGGGTGCTGG - Intronic
1029695047 7:102207298-102207320 ATGACATGGAAGGCGGGTGGGGG - Intronic
1034148698 7:148895876-148895898 ATCACACGGAGGCTGGGTGCAGG - Intergenic
1034634755 7:152558363-152558385 ATACCAGGCAGGCCGGGTGCGGG - Intergenic
1035132720 7:156670362-156670384 ATCCCCTGGAAAGCGGGTCCAGG + Intronic
1035286927 7:157812680-157812702 CACCCTTGGTAGCCGGGTGCTGG + Intronic
1035754647 8:2022415-2022437 AGCCCATGGACACCAGGTGCAGG - Intergenic
1036540197 8:9700139-9700161 ATCCCATGGAAGGGGAGTTCAGG - Intronic
1036627693 8:10485052-10485074 TTCCCATGGCAGCTGTGTGCAGG + Intergenic
1041735415 8:61105953-61105975 ATCCCTTGGAAGCCAGAAGCCGG + Intronic
1045322343 8:101091626-101091648 ACCCCATGGCAGCCCTGTGCCGG + Intergenic
1046721644 8:117626764-117626786 ATCCCATGGAAGTCTGGATCTGG - Intergenic
1052350335 9:27452055-27452077 ACCCTATGGAAGCAAGGTGCAGG + Intronic
1054873413 9:70070224-70070246 ATCCTATGGAAGACTGGTCCTGG + Intronic
1061208518 9:129177644-129177666 AGCCCCTGGGCGCCGGGTGCTGG + Exonic
1061934291 9:133848798-133848820 ATCCCATGGCAGCCTGGCACCGG + Intronic
1062458828 9:136654352-136654374 ATCCCAGGGAAGCCAGGGCCAGG + Intergenic
1186063564 X:5737785-5737807 ATCCCCTGGAAGCAGGGTGGAGG - Intergenic
1189498673 X:41532894-41532916 ATCGCTTGGAACCCGGGAGCTGG - Intronic
1201532756 Y:15010288-15010310 ATCCCCTGGAAGCAGGGTGGAGG + Intergenic