ID: 1165984467

View in Genome Browser
Species Human (GRCh38)
Location 19:39755925-39755947
Sequence CACTGTGTCTGGAGTAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165984467_1165984476 25 Left 1165984467 19:39755925-39755947 CCCCCTCTACTCCAGACACAGTG No data
Right 1165984476 19:39755973-39755995 CTATTGACACTTCCTCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165984467 Original CRISPR CACTGTGTCTGGAGTAGAGG GGG (reversed) Intergenic
No off target data available for this crispr