ID: 1165991597

View in Genome Browser
Species Human (GRCh38)
Location 19:39818356-39818378
Sequence CTTGGGCTGTGAAGCGTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165991597_1165991611 29 Left 1165991597 19:39818356-39818378 CCCTTAACGCTTCACAGCCCAAG No data
Right 1165991611 19:39818408-39818430 CTTTCCTGTTTGCTCAATCCAGG No data
1165991597_1165991602 0 Left 1165991597 19:39818356-39818378 CCCTTAACGCTTCACAGCCCAAG No data
Right 1165991602 19:39818379-39818401 GCCTGCCAGATCCACCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165991597 Original CRISPR CTTGGGCTGTGAAGCGTTAA GGG (reversed) Intergenic
No off target data available for this crispr