ID: 1165991987

View in Genome Browser
Species Human (GRCh38)
Location 19:39821111-39821133
Sequence GAGTAGAAGCAGAATCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165991981_1165991987 18 Left 1165991981 19:39821070-39821092 CCGCGGGCTGGGGCAGATCTATA No data
Right 1165991987 19:39821111-39821133 GAGTAGAAGCAGAATCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165991987 Original CRISPR GAGTAGAAGCAGAATCTGCC AGG Intergenic
No off target data available for this crispr