ID: 1166001736

View in Genome Browser
Species Human (GRCh38)
Location 19:39881548-39881570
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166001736_1166001742 9 Left 1166001736 19:39881548-39881570 CCCTGTTCGTACAGTTACTACAT 0: 2
1: 0
2: 0
3: 8
4: 66
Right 1166001742 19:39881580-39881602 CAGCTTGCGGAACCCCTGTGTGG 0: 2
1: 0
2: 0
3: 3
4: 78
1166001736_1166001744 15 Left 1166001736 19:39881548-39881570 CCCTGTTCGTACAGTTACTACAT 0: 2
1: 0
2: 0
3: 8
4: 66
Right 1166001744 19:39881586-39881608 GCGGAACCCCTGTGTGGGAGAGG 0: 2
1: 0
2: 0
3: 14
4: 136
1166001736_1166001738 -4 Left 1166001736 19:39881548-39881570 CCCTGTTCGTACAGTTACTACAT 0: 2
1: 0
2: 0
3: 8
4: 66
Right 1166001738 19:39881567-39881589 ACATCTGTGACCCCAGCTTGCGG 0: 2
1: 0
2: 2
3: 36
4: 381
1166001736_1166001743 10 Left 1166001736 19:39881548-39881570 CCCTGTTCGTACAGTTACTACAT 0: 2
1: 0
2: 0
3: 8
4: 66
Right 1166001743 19:39881581-39881603 AGCTTGCGGAACCCCTGTGTGGG 0: 2
1: 0
2: 0
3: 2
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166001736 Original CRISPR ATGTAGTAACTGTACGAACA GGG (reversed) Intronic
906619422 1:47263172-47263194 ATGTAGTAACTTTAGAAAAAAGG + Intronic
908306745 1:62826543-62826565 AGGTAGTAACTGTAAAAATAGGG - Intronic
909684803 1:78335864-78335886 ATGTAATAATTGGAAGAACAAGG - Intronic
913185421 1:116366315-116366337 ATGTAGTAACTGTTCAAAGAGGG - Intergenic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
1062781956 10:220275-220297 ATGTAGTAACCAAATGAACAAGG - Intronic
1064499513 10:15954360-15954382 ATTTACTAACTGTACGATCTTGG - Intergenic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088465274 11:110128521-110128543 AAGTAGTAACTGTAGTAGCAAGG + Intronic
1091574349 12:1719463-1719485 ATTTAGTAACTATATGAACATGG + Intronic
1093229020 12:16520393-16520415 ATATAATAACTGTATGCACAGGG + Intronic
1098576575 12:72049381-72049403 AAGTAGTACCTGTAGGAACAGGG + Intronic
1099940718 12:89184738-89184760 ATGTAGTAACTATGCGATCTTGG - Intergenic
1100612085 12:96199137-96199159 ATGTAGTAACAGGAAGTACAGGG + Intronic
1101479126 12:105079954-105079976 ATGAATTATATGTACGAACAAGG - Intronic
1111290371 13:86160175-86160197 ATGTTGTCACTGTAGAAACATGG + Intergenic
1115634543 14:35279012-35279034 AAGAAGTGACTGTAAGAACAGGG - Intronic
1117108847 14:52427702-52427724 ATTTAGTAACTGAAAGAACGTGG - Intergenic
1120281049 14:82438331-82438353 ATGGAAAAACTGTACGATCAGGG + Intergenic
1124712533 15:32027933-32027955 ATTTAGTAACTTTACACACATGG - Intergenic
1152556247 17:81054585-81054607 ATGTAGAAACTGTGGGATCAGGG + Intronic
1157797830 18:50591762-50591784 ATTTAGTAAATGCAAGAACATGG + Intronic
1165223808 19:34339732-34339754 ATTCAGTAACTGTAAGAACATGG - Intronic
1166001736 19:39881548-39881570 ATGTAGTAACTGTACGAACAGGG - Intronic
1166004518 19:39897799-39897821 ATGTAGTAACTGTACGAACAGGG - Intronic
925667412 2:6275096-6275118 ATGAACTAACTGCAAGAACAAGG + Intergenic
926550775 2:14298591-14298613 ATTTGGTAACTGTACAACCAAGG + Intergenic
929179051 2:39013405-39013427 ATGTAATAAAAGTACCAACACGG - Intronic
936830411 2:116638328-116638350 CTGTAGTAACTAAAAGAACATGG + Intergenic
937476601 2:122220663-122220685 ATTTACTCACTGTAAGAACAAGG + Intergenic
940497800 2:154455634-154455656 ATTTAGTAGCAGTTCGAACATGG - Intergenic
945613928 2:212043740-212043762 ATGTAGTAAGTGTTGGAGCAGGG - Intronic
1170083211 20:12499738-12499760 CTGTTGTAACTGAAAGAACATGG - Intergenic
1176902339 21:14458062-14458084 ATGTAGTCACTCTACGCATATGG + Intergenic
1182861936 22:33567917-33567939 ATGAAGTAAGTGTAGCAACATGG - Intronic
949444649 3:4120847-4120869 ATTTACTAACTGTATGACCATGG + Intronic
953823328 3:46228709-46228731 ATTTGATAACTGTACAAACATGG + Intronic
959259877 3:104063857-104063879 ATGTGGTAAATGTATGAAAATGG + Intergenic
959358358 3:105360065-105360087 TTGTAGGAACTGTAGGAACGAGG + Intergenic
959545392 3:107590269-107590291 ATGTAGTGACTGTACATATATGG + Intronic
959637393 3:108590302-108590324 ATGTAGAAATTGTAAGAATAGGG + Intronic
965715875 3:171602493-171602515 TTTCAGTCACTGTACGAACACGG - Exonic
966125047 3:176566297-176566319 ATGTAGTAACTCTACGTAAGAGG + Intergenic
966418079 3:179709594-179709616 AGGTATTAACTGTACAAACATGG - Intronic
967276164 3:187777295-187777317 ATGTAGCAGCTGTACAAACTTGG - Intergenic
970027209 4:11636215-11636237 ATGTATTAACTGTGCGACCTTGG + Intergenic
971784859 4:31087176-31087198 ATGTAGAAATTATTCGAACAGGG - Intronic
971943782 4:33248315-33248337 ATGAAATAACTGTACAATCAAGG - Intergenic
976041620 4:80892118-80892140 CTGTAATAACTGAAAGAACATGG + Intronic
979409065 4:120352204-120352226 ATATACTAAATGTATGAACAGGG - Intergenic
979656854 4:123205309-123205331 ATTTAGTAGCTGTATGAACCTGG + Intronic
981670243 4:147278458-147278480 ATGTTACAACTGTAAGAACAAGG - Intergenic
984480945 4:180301223-180301245 ATGTAATAACTGTATTAAAAAGG - Intergenic
985167923 4:187117238-187117260 ATGAAGTAATTCTAGGAACATGG + Intergenic
990766223 5:59186230-59186252 ATGTAGTAAATGTGTGAACTTGG + Intronic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
999700453 5:154223344-154223366 ATGTCCTAGCTGTACGAACTGGG - Intronic
1001401211 5:171447518-171447540 ATTTAGTAACTCTAGAAACAGGG - Intronic
1006597612 6:35204885-35204907 ATGTGGTAAATGTCCAAACATGG - Intergenic
1014398934 6:120963416-120963438 ATGTAGAAACTATACTAAAATGG - Intergenic
1014582168 6:123152094-123152116 ATGTACTAACTGTACGGCCATGG - Intergenic
1027542705 7:79488008-79488030 ATGTAGTCACTGAACTAAAATGG - Intergenic
1027640988 7:80733689-80733711 ATGCAGAAACTGTCAGAACAAGG - Intergenic
1029691520 7:102185203-102185225 ATGTAGTAATTGTAGTAACAAGG + Intronic
1031330005 7:120452835-120452857 ATGGGGTAACTGTAGGAACTAGG + Intronic
1038107028 8:24447513-24447535 ATATAGTCACTCTAAGAACAGGG + Intronic
1039739758 8:40371889-40371911 ATTTAGTAAATGTCCAAACATGG + Intergenic
1043478066 8:80624819-80624841 ATTTACTAACTGTATGACCATGG - Intergenic
1047994134 8:130317405-130317427 TTGTTGAAACTGTAGGAACAGGG + Intronic
1048544173 8:135370703-135370725 ATGGAGTAAGTGAACCAACATGG + Intergenic
1052109226 9:24559969-24559991 ATGTATTAACTGTATGAACGTGG + Intergenic
1052510377 9:29410845-29410867 ACTTAGTAACTATACAAACATGG + Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1189102047 X:38200775-38200797 CTGTAGTAACAGTATTAACAGGG - Intronic
1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG + Intronic