ID: 1166003020

View in Genome Browser
Species Human (GRCh38)
Location 19:39889532-39889554
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166003020_1166003030 17 Left 1166003020 19:39889532-39889554 CCGTGATCACCCTGGTCACACTG 0: 2
1: 0
2: 1
3: 25
4: 230
Right 1166003030 19:39889572-39889594 GGCCACGTTCTCCTGCAGGACGG 0: 2
1: 0
2: 0
3: 13
4: 174
1166003020_1166003028 13 Left 1166003020 19:39889532-39889554 CCGTGATCACCCTGGTCACACTG 0: 2
1: 0
2: 1
3: 25
4: 230
Right 1166003028 19:39889568-39889590 CCCAGGCCACGTTCTCCTGCAGG 0: 2
1: 0
2: 1
3: 14
4: 230
1166003020_1166003023 -4 Left 1166003020 19:39889532-39889554 CCGTGATCACCCTGGTCACACTG 0: 2
1: 0
2: 1
3: 25
4: 230
Right 1166003023 19:39889551-39889573 ACTGACTCGCCCATTACCCCAGG 0: 2
1: 0
2: 0
3: 1
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166003020 Original CRISPR CAGTGTGACCAGGGTGATCA CGG (reversed) Exonic
900291637 1:1926198-1926220 CAGTGTGGCCAGGGTGGGCCTGG + Intronic
900601386 1:3504191-3504213 CTGTGTGACCAGCATGACCATGG - Intronic
901067999 1:6503772-6503794 CTCTGTGGCCAGTGTGATCAAGG + Intronic
901862681 1:12084952-12084974 CTGTGTGACCCTGGTCATCAAGG - Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905340223 1:37272915-37272937 CAGTGGGAGCAGGGAGCTCAGGG + Intergenic
909102517 1:71367276-71367298 AAGTGTGCCCAGGGTGACCCAGG - Intergenic
910310902 1:85823561-85823583 CCAGGTGACCAGGGTGAACAAGG - Exonic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912451571 1:109770640-109770662 CAGTGGGGCCAGGGTAATCCAGG - Intronic
912627229 1:111215525-111215547 ACATGTGTCCAGGGTGATCAGGG - Intronic
914046684 1:144099515-144099537 CAGTGTGACCGTGGTTAACAAGG - Intergenic
914131426 1:144861171-144861193 CAGTGTGACCGTGGTTAACAAGG + Intergenic
915742274 1:158127949-158127971 TAGAGTGACCAGAGTCATCAGGG + Intergenic
915860392 1:159437920-159437942 TAGGGTGACCAAGGTGAGCAAGG - Intergenic
916080628 1:161229746-161229768 CAGTGTATCCAGGGTGTTCCAGG + Exonic
917758863 1:178133332-178133354 CAGTGTCACCAAAGTGATCATGG - Intronic
918804409 1:189020845-189020867 CACTGTCAGCTGGGTGATCATGG + Intergenic
919740910 1:200981141-200981163 GACTGTGGCCAGGCTGATCAAGG + Intronic
922536893 1:226387671-226387693 CAATGTCACCTGGGTGACCAAGG + Intronic
922652837 1:227355930-227355952 CATTGTTACCAGGCTGTTCAAGG + Intergenic
1063009315 10:2007114-2007136 CTGTGTCACCAGGCTGATCTCGG - Intergenic
1063466409 10:6247968-6247990 CAGGGTGACCTGTGTGATCTGGG - Intergenic
1064230002 10:13521549-13521571 CAGTGGGGCCAGGGTGCTGAAGG + Intronic
1067023116 10:42819369-42819391 CAGTGTGACTAGTGTGATTGAGG + Intronic
1068145693 10:53067698-53067720 AAGTGAGACCAGGATGAACATGG + Intergenic
1069906218 10:71734176-71734198 CAGAATGACCAGGGTTAACAAGG + Intronic
1070331629 10:75421665-75421687 CAGGGTGGACAGGGTGATTAGGG + Intergenic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1072202473 10:93173175-93173197 CAATGTGACCAGGGATAGCAGGG + Intergenic
1074774023 10:116753219-116753241 CAGTGGGGCCAGGATGGTCAGGG + Intergenic
1075250659 10:120868680-120868702 AAGTGTGACCCGGGTAATCCTGG + Intronic
1077080843 11:724130-724152 CAGTGTGGCCCTGGTCATCAGGG - Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1078438070 11:11341831-11341853 CACTGTGCCCAGCCTGATCAAGG - Intronic
1078739189 11:14050778-14050800 CAGTGTGCCCAGGGTAAACCGGG + Intronic
1080878340 11:36296670-36296692 CTGGGTGACCAGGGTCTTCATGG + Intronic
1081589337 11:44410093-44410115 CTGTGTGACCTGGGTCATGATGG + Intergenic
1081864718 11:46353227-46353249 CAGTGTGAGCTGGGGGATCCTGG - Intronic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083296063 11:61716259-61716281 CAGTGTGACCAGGGCCATGCTGG + Intronic
1083319753 11:61838499-61838521 GGCTGTGACCAGGGTGGTCATGG + Intronic
1084630616 11:70346185-70346207 CAGTGTGACCAGGGGGTGCCTGG + Intronic
1084870954 11:72098246-72098268 CAGTGTGAGAAGGGTGGGCAGGG + Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1087440989 11:98183620-98183642 CAGTTTCACCAGGGTGAAAATGG + Intergenic
1088895195 11:114073127-114073149 CTGGGTGACCAGGGGGCTCATGG + Intronic
1090058628 11:123444719-123444741 TGGTGTGTCCAGGGTGAACACGG - Intergenic
1090210010 11:124912434-124912456 CAGTGTCCCCAGTGTCATCAGGG + Intergenic
1090221958 11:125034255-125034277 CAGTGTCCCCAGTGTCATCAGGG + Intronic
1090531925 11:127600091-127600113 CAGTGTGACCAGCTTGTTGAAGG + Intergenic
1091389860 12:119488-119510 CAGAGAGACCAGGGTAATCCTGG + Intronic
1094413352 12:30191439-30191461 TAATGTGACCAGTGTGATCTTGG - Intergenic
1096967051 12:55637019-55637041 CTGTGTGAGGAGGATGATCAGGG - Exonic
1101582000 12:106049896-106049918 CAGTGAGGCCATGGTGATAACGG - Intergenic
1101822906 12:108197570-108197592 CAATGAGACAAGGGTGATGAAGG + Intronic
1102634276 12:114309199-114309221 AAGTGTGACAAGTGTGATCAAGG - Intergenic
1102776313 12:115522669-115522691 CAGGGTGTTCAGGGTGTTCAGGG + Intergenic
1102868172 12:116390987-116391009 GAGAGTGACCATGGTGCTCATGG - Intergenic
1102997196 12:117360234-117360256 CACTGTGACCAGAGAGCTCATGG - Intronic
1103858450 12:123991794-123991816 ATGTGTTATCAGGGTGATCAAGG - Intronic
1103971250 12:124674185-124674207 GAGTGTGATCAGGGTGTCCAGGG - Intergenic
1104615324 12:130263344-130263366 CAGCGTGACCAGGAAGAACAGGG + Intergenic
1104796958 12:131526725-131526747 CAGTGTGACCAGGGGGTTCTGGG + Intergenic
1105351909 13:19623556-19623578 CAAGGTGACCAGGGCCATCATGG - Intergenic
1114375662 14:22144036-22144058 CAGTGTGATAAGGGTGGTGAGGG - Intergenic
1114758606 14:25286391-25286413 CAGTGTCCCCAGTGTCATCAGGG + Intergenic
1118400783 14:65377518-65377540 TAGTGAGACCAGAGTGTTCATGG + Intergenic
1121089820 14:91173514-91173536 CGATGTGAACAGGGGGATCATGG - Intronic
1121465265 14:94111718-94111740 CAGTGTGGCCAAAGTGGTCAGGG + Exonic
1122693583 14:103542560-103542582 CAGTGTGACCCTGGTGATGGGGG - Intergenic
1123088927 14:105733183-105733205 CAGCGTGAACAGGGTGATGATGG - Intergenic
1123424267 15:20156549-20156571 CAGTGTGACTAGTGTGATTGAGG + Intergenic
1123533489 15:21163078-21163100 CAGTGTGACTAGTGTGATTGAGG + Intergenic
1124027539 15:25980668-25980690 GAGTGAGATCAGGGTGAGCATGG + Intergenic
1124155135 15:27218975-27218997 CGGTATGGCCAGGGTCATCAGGG - Intronic
1124346114 15:28922641-28922663 CAGTGGGAGCAGGGTCATCGAGG - Intronic
1124613297 15:31223761-31223783 CAGGGGGCCCAGGGTGACCACGG + Intergenic
1125727038 15:41873445-41873467 CAGTGTGGTCTGGGTGATGATGG - Intronic
1126881694 15:53105823-53105845 CAGTGTGACCAGGGACACCATGG + Intergenic
1129727182 15:77907314-77907336 CAGGGTGGCCATGGGGATCAAGG + Intergenic
1131202063 15:90407218-90407240 GAGTATGACCAGGATGATAAAGG + Intronic
1133143099 16:3762760-3762782 AAATGTGACCAGGGTGACCGAGG - Intronic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1135186508 16:20320423-20320445 CTGTGGGCCCAGGGAGATCAAGG - Exonic
1136860597 16:33699338-33699360 CAGTGTGACTAGTGTGATTGAGG - Intergenic
1137359291 16:47798155-47798177 GACTGTGACCAGGGTGGTGATGG + Intergenic
1137754352 16:50889601-50889623 CAGTCTGAGCAGGGTGATGAAGG - Intergenic
1138024520 16:53512087-53512109 CAGTGTGACCACGCTGAACCTGG + Intergenic
1139049588 16:63107444-63107466 CATTTTAAACAGGGTGATCAGGG + Intergenic
1139680508 16:68558210-68558232 AACTGTGACCAGGGTGCTCAGGG + Intronic
1139950326 16:70665178-70665200 CAGGGTGTCCAGGGCTATCAGGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1203122097 16_KI270728v1_random:1547521-1547543 CAGTGTGACTAGTGTGATTGAGG - Intergenic
1142804403 17:2363871-2363893 CAGTGGCACCAGGCTGACCAGGG + Intronic
1143119785 17:4599595-4599617 GAGGGTGACCAAGGTGACCAGGG - Intronic
1143306567 17:5952230-5952252 CAGCTTGACCAAGGTGGTCAAGG + Intronic
1143617850 17:8064256-8064278 GAGGGGGACCAGGGTGGTCATGG + Intergenic
1148697618 17:49570595-49570617 CTCTGTGGCCAGGGTGATCTGGG - Intergenic
1149943667 17:60898759-60898781 CAGTGTAACATGGGTGATAACGG + Intronic
1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG + Intergenic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152611864 17:81318973-81318995 CAGTTTGCCCAGGGCGATCCCGG - Intronic
1155219548 18:23671819-23671841 CAGTATGGGGAGGGTGATCAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1158417139 18:57258431-57258453 TAGTGTGCCCAGGGTGCCCATGG - Intergenic
1161105903 19:2443925-2443947 GTGTGTGACCAGGGTGCTCATGG - Intronic
1163017014 19:14462693-14462715 AAGTGTGACCAGTGTGACCAGGG + Intronic
1163203203 19:15782822-15782844 GAGGGTGAACAGGGTGATGATGG + Intergenic
1163645245 19:18485529-18485551 CAGGGAGACCAGGGAGACCAGGG + Intronic
1164797703 19:31047476-31047498 CAGGGTTTCCAGGGTCATCATGG - Intergenic
1165972123 19:39640344-39640366 CAGTATCACCAGAGAGATCAGGG + Intergenic
1166003020 19:39889532-39889554 CAGTGTGACCAGGGTGATCACGG - Exonic
1166005807 19:39905784-39905806 CAGTGTGACCAGGGTGATCACGG - Exonic
1168314470 19:55478451-55478473 CTGGGTGACCAGAGTGACCAGGG + Intronic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
1202686238 1_KI270712v1_random:52929-52951 CAGTGTGACCGTGGTTAACAAGG - Intergenic
926934202 2:18070925-18070947 CACTATGACCAGTGTGATCCAGG - Intronic
928040646 2:27873027-27873049 CAGTGGGGCCAGGGTAATGATGG + Intronic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
931973158 2:67612818-67612840 CAATGTGACCAGATTGCTCAAGG + Intergenic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
934245485 2:90301891-90301913 CAGTGTGACCATGGTTAACAAGG + Intergenic
934263261 2:91495148-91495170 CAGTGTGACCGTGGTTAACAAGG - Intergenic
934458977 2:94200490-94200512 CAGTGTGACTAGTGTGATTGAGG - Intergenic
934951410 2:98578258-98578280 CAGTGTGACCCTGGTGCTGAGGG + Intronic
935261745 2:101361850-101361872 CAGGGTCCCCAGGGTGCTCAGGG - Intronic
939870313 2:147519485-147519507 CAGTGTGCCAAGGGTGCTCCTGG + Intergenic
940968624 2:159869358-159869380 CAGTGTGACTTTGGTGATCATGG - Intronic
943070485 2:183135342-183135364 CAGTGTGTCTGGGGTGTTCAAGG + Intronic
944192874 2:197022277-197022299 GACTTTGACCAGGGTGATTACGG - Intronic
944865861 2:203860989-203861011 CATTGTGAACAGGGTTGTCAGGG - Intergenic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948002644 2:234580792-234580814 AAGTGTGACCGAGGTGCTCATGG - Intergenic
948509793 2:238456136-238456158 CAGTGTGACAAGGCTGGTGAGGG - Intergenic
948515077 2:238498546-238498568 GAGTGTGGCCAGGATGATCTAGG + Intergenic
948640571 2:239373372-239373394 CAGTGTGACCAGGCAGCCCAGGG - Intronic
1171296343 20:24020427-24020449 CAGTGTCCCCAGTGTCATCAGGG - Intergenic
1172298167 20:33828581-33828603 CTGTGTGACCAGGCTGAACAAGG + Intronic
1172872593 20:38144940-38144962 CAGGGTGACCAGGATGACCAGGG + Intronic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1179584080 21:42364188-42364210 CAGGGTGCCCAGGGTAACCACGG + Intronic
1181357237 22:22305974-22305996 CAGTGTGACTAGTGTGATTGAGG + Intergenic
1182167397 22:28190081-28190103 CTGTGTGACCATGGTGACCATGG - Intronic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1182753371 22:32659123-32659145 CAGTGTAACCAAGGTGAGTAAGG + Intronic
1183501263 22:38181100-38181122 GCATGTGACCAGGGTGATCATGG - Intronic
1183511424 22:38237423-38237445 CAGTGTGCCCAGGGTCATCGGGG - Intronic
950454497 3:13084560-13084582 CAGAGTGCCCAGGGCCATCATGG - Intergenic
950459448 3:13112534-13112556 CAGTCTGTCTAGGGTGGTCAGGG + Intergenic
950685900 3:14618471-14618493 CAGTGTGACCAGGCTGCCCCGGG - Intergenic
951601263 3:24378470-24378492 CCTTGTGATCACGGTGATCATGG + Intronic
953031061 3:39180335-39180357 CAGTGTGACTAGGGTGATGTGGG + Intergenic
954335213 3:49912285-49912307 CAGTGTGACCAAGATGGGCAAGG - Intronic
956410583 3:68974275-68974297 CAGTGTGGCTGGTGTGATCAAGG - Intergenic
957044766 3:75365006-75365028 CAGCGTAACCAGTGTGCTCATGG - Intergenic
960268433 3:115648119-115648141 CAGTGTGACAAGGCTCGTCATGG + Intronic
963047632 3:141114578-141114600 CAGTGTGCCCAGGCTGGCCACGG - Intronic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
969619984 4:8274027-8274049 CAGATTGACCAAGGTGATCCTGG - Intronic
974509521 4:62820267-62820289 CAGTGTTACCAAGGTAAGCAAGG + Intergenic
978462663 4:108974374-108974396 CAGGGAGAACAAGGTGATCAGGG - Exonic
978556445 4:109985699-109985721 CAGTGTGATGAATGTGATCAAGG - Intronic
978899438 4:113929513-113929535 CAGTGTCCCCAGGTTTATCAGGG + Intronic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
982173658 4:152684832-152684854 GAGTGAGACGAGGGTAATCAAGG - Intergenic
983641895 4:169950971-169950993 CAGTGTGTCCAGGGACTTCACGG - Intergenic
984825876 4:183924307-183924329 CAGTGGGATGAGGGTGATGATGG + Intronic
985360741 4:189172799-189172821 CTGTGAGACAGGGGTGATCACGG + Intergenic
986742637 5:10717436-10717458 CAGTGTGCCCAGCTTCATCAGGG - Intronic
986916321 5:12625023-12625045 CAGTGTCCCCAGGGTGTGCAGGG - Intergenic
988779951 5:34511482-34511504 CAGTGTCACCCAGGTGATCTGGG - Intergenic
989669662 5:43900892-43900914 CAGTGTGAGCAGAGTGTTCTAGG - Intergenic
990217181 5:53547769-53547791 CAGTTTGACCAGGATAGTCATGG + Intergenic
990893540 5:60673110-60673132 CAGGTTGGTCAGGGTGATCAAGG - Intronic
991219734 5:64199370-64199392 CAGTATGGTCAGGGTGAACACGG - Intronic
992481580 5:77157029-77157051 CAGCTTCAGCAGGGTGATCATGG + Intergenic
994089529 5:95797541-95797563 ATGTGGGACCAAGGTGATCAGGG + Intronic
996647066 5:125829032-125829054 CAGAGTGAGCAGGTAGATCAGGG - Intergenic
996834356 5:127775115-127775137 TAGTGTAACCAGGGTCACCAAGG - Intergenic
997353822 5:133249517-133249539 CAGTGTGACCACAGTGACCGTGG - Exonic
998380049 5:141717852-141717874 CAGTATGGCCAGGGTGGTGATGG + Intergenic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
1000158073 5:158571549-158571571 CAGGGTGACCAGTTTGAACATGG - Intergenic
1000669866 5:164047617-164047639 CAGTGTGACAAGAGTAATAATGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002135915 5:177107450-177107472 GACTTTGGCCAGGGTGATCAGGG - Intergenic
1003173555 6:3738442-3738464 GGCTGTGACCAGGGTGATTATGG - Intronic
1003254790 6:4465552-4465574 CAGTGTGACAGGGGCTATCATGG - Intergenic
1004153604 6:13146243-13146265 AAGTGTTACCATGGTGATAATGG + Intronic
1004308724 6:14524517-14524539 CAGTGTGTCCAGGGTGCTACAGG - Intergenic
1004803955 6:19181719-19181741 GAGTGTGACAAGGATGATCATGG + Intergenic
1005016578 6:21380227-21380249 CAATGTGACCAGGGCTATGAAGG - Intergenic
1006258668 6:32850989-32851011 CAGGGTGATCAGGGTGACCATGG + Exonic
1006838928 6:37015788-37015810 CTGTGTGCCCAGGGTGATCCAGG + Exonic
1007854326 6:44839202-44839224 TAGTGTGATAAGGGTGATCTGGG - Intronic
1010953530 6:82064815-82064837 CAGTGTGTCCAGGGTAACAAAGG + Intergenic
1011124034 6:83987126-83987148 GAGTCAGACCAGGGTAATCAGGG + Intergenic
1011437278 6:87351736-87351758 CAGGGTGACCAAGGTGATAGAGG - Intronic
1011810112 6:91121602-91121624 CAGTATGACCAGGCTGGGCACGG - Intergenic
1016219852 6:141654937-141654959 CAGTGTGCCCAGCTTCATCAGGG - Intergenic
1016416024 6:143834811-143834833 CACTGTGGCCAGGATGATTAGGG - Intronic
1016490684 6:144598172-144598194 ACATGTGCCCAGGGTGATCAGGG + Intronic
1016685557 6:146878677-146878699 CAGTGTGCCCAGGGTAACCCAGG - Intergenic
1018802936 6:167237412-167237434 ACGTGTGACCCAGGTGATCAGGG - Intergenic
1023779152 7:43640025-43640047 CAGTGAGCCCAGGGTGAGCTAGG + Intronic
1026901171 7:74038310-74038332 CTGTGGGACCAGGGTCAGCAGGG - Intronic
1027627412 7:80563565-80563587 CAGGGGGACCAAGGTGACCAAGG + Intronic
1028733800 7:94183496-94183518 CAGTGTTACTATGGGGATCATGG - Intergenic
1028755278 7:94427005-94427027 AAGGGTCACCATGGTGATCAAGG + Exonic
1030327114 7:108231969-108231991 CAGTATGATATGGGTGATCAAGG - Intronic
1031657734 7:124379451-124379473 GAGTGAGACCACAGTGATCATGG + Intergenic
1032237983 7:130141152-130141174 AAGTGTGACCAGAGTGTTCGGGG + Intergenic
1033021942 7:137734244-137734266 GAGTGGGAGCAGGGAGATCAGGG + Intronic
1034152352 7:148926843-148926865 CAGGGTGAAGTGGGTGATCAGGG - Intergenic
1036296814 8:7543956-7543978 ACGTGTGTCCAAGGTGATCAGGG + Intergenic
1036325753 8:7777063-7777085 ACGTGTGTCCAAGGTGATCAGGG - Intergenic
1037995719 8:23351013-23351035 CTGTGTTACCATGGTGATGATGG - Intronic
1038801874 8:30756753-30756775 GTGTTTGACCAGGGTGATGAAGG + Exonic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1041011602 8:53549337-53549359 CAGTGTCTCCAGGGTCAGCAAGG - Intergenic
1042390698 8:68230397-68230419 CAGTGGGACCAGTGTGGCCATGG + Intronic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1049222217 8:141433347-141433369 CAGTGTGTCCAGGGTGGGCCTGG + Intergenic
1049399187 8:142417292-142417314 CAGTGGGAACAGGGTCTTCATGG - Intergenic
1049412906 8:142481394-142481416 CTGTGTGGCCAGGGTGATTGGGG - Intronic
1049744101 8:144255881-144255903 CAGTGTGAGAAGGGTGGCCATGG - Intronic
1052489805 9:29150944-29150966 CAGAGTCACCAGAGTCATCAAGG + Intergenic
1052786146 9:32830469-32830491 CAGTGTGGCCAGGAAGTTCAGGG + Intergenic
1053689470 9:40576279-40576301 CAGTGTGACTAGTGTGATCGAGG - Intergenic
1054274561 9:63054778-63054800 CAGTGTGACTAGTGTGATTGAGG + Intergenic
1054300715 9:63377218-63377240 CAGTGTGACTAGTGTGATTGAGG - Intergenic
1054400263 9:64710151-64710173 CAGTGTGACTAGTGTGATTGAGG - Intergenic
1054433854 9:65194409-65194431 CAGTGTGACTAGTGTGATTGAGG - Intergenic
1054496532 9:65827261-65827283 CAGTGTGACTAGTGTGATTGAGG + Intergenic
1056058229 9:82851959-82851981 ATGTGTGCCCAAGGTGATCAGGG - Intergenic
1058007654 9:99935899-99935921 CAGTGTGGCTAGTGTGAGCAAGG + Intronic
1059722368 9:116973407-116973429 AAGTGTGAACTGTGTGATCATGG - Intronic
1061456354 9:130700848-130700870 CAGCCTGGCCAGGGTGATGAAGG - Exonic
1186904741 X:14099151-14099173 CACTGTGGCTAGGGTGAGCATGG - Intergenic
1188327530 X:28823800-28823822 CAGTGTTCCCAATGTGATCAGGG - Intronic
1189065132 X:37799643-37799665 AAGTGTGGCAAGGGTGACCAAGG + Intronic
1191742880 X:64453977-64453999 CAGTGTCCCCAGGTTCATCAGGG + Intergenic
1192298070 X:69870663-69870685 CAGTGTGCCCAGCTTCATCAGGG + Intronic
1192542954 X:71990546-71990568 CAGTGTGAGCGGGGTGGTCTTGG - Intergenic
1193415401 X:81216494-81216516 CAGTGCAACCAGGGTGACTATGG - Intronic
1193937961 X:87645408-87645430 CAGTGTGATCGCGGTGAACAGGG + Intronic
1195002428 X:100654937-100654959 CAGTGTGACTAGCTTGCTCAGGG - Intronic
1195619185 X:106936026-106936048 CAGTGAGACCTGGTTAATCATGG - Intronic
1196243307 X:113368796-113368818 GAGAGTGACCAGTGTGATTAGGG - Intergenic
1198177923 X:134173529-134173551 CATTGTTACCAGGGTGATTGTGG + Intergenic
1198330392 X:135617394-135617416 CAGAGTGGCCAAGGTGACCAAGG - Intergenic
1198336535 X:135671605-135671627 CAGAGTGGCCAAGGTGACCAAGG + Intergenic
1198648618 X:138837229-138837251 CAGCGTGTCCATGGTGACCAGGG - Intronic
1199166334 X:144679774-144679796 CCGTGTGACCAGGGGACTCATGG + Intergenic
1199993648 X:153004918-153004940 CAGTGTCACAAGGCTGAGCAGGG + Intergenic
1200740489 Y:6848326-6848348 CAGTGTCACCAGGCTAATCCAGG + Intergenic