ID: 1166007085

View in Genome Browser
Species Human (GRCh38)
Location 19:39915363-39915385
Sequence GGCCGGCGCTTCGACTTCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 2, 3: 0, 4: 14}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166007085_1166007091 6 Left 1166007085 19:39915363-39915385 CCCATGAAGTCGAAGCGCCGGCC 0: 1
1: 0
2: 2
3: 0
4: 14
Right 1166007091 19:39915392-39915414 GCTCACATAGTGTGGGTCCCCGG 0: 1
1: 0
2: 1
3: 7
4: 93
1166007085_1166007093 18 Left 1166007085 19:39915363-39915385 CCCATGAAGTCGAAGCGCCGGCC 0: 1
1: 0
2: 2
3: 0
4: 14
Right 1166007093 19:39915404-39915426 TGGGTCCCCGGACCCCTGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 233
1166007085_1166007089 -2 Left 1166007085 19:39915363-39915385 CCCATGAAGTCGAAGCGCCGGCC 0: 1
1: 0
2: 2
3: 0
4: 14
Right 1166007089 19:39915384-39915406 CCGTCGAAGCTCACATAGTGTGG 0: 1
1: 0
2: 2
3: 2
4: 19
1166007085_1166007090 -1 Left 1166007085 19:39915363-39915385 CCCATGAAGTCGAAGCGCCGGCC 0: 1
1: 0
2: 2
3: 0
4: 14
Right 1166007090 19:39915385-39915407 CGTCGAAGCTCACATAGTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 33
1166007085_1166007092 14 Left 1166007085 19:39915363-39915385 CCCATGAAGTCGAAGCGCCGGCC 0: 1
1: 0
2: 2
3: 0
4: 14
Right 1166007092 19:39915400-39915422 AGTGTGGGTCCCCGGACCCCTGG 0: 1
1: 0
2: 2
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166007085 Original CRISPR GGCCGGCGCTTCGACTTCAT GGG (reversed) Exonic
902896911 1:19485499-19485521 GCCCGGCGCTTCCACTTCCCCGG + Intronic
1076662535 10:132065061-132065083 GGCCTGCGCTGAGACTGCATCGG - Intergenic
1111209363 13:85056690-85056712 GTCCGGGTCATCGACTTCATCGG + Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1139250945 16:65495384-65495406 CGTCTGTGCTTCGACTTCATGGG + Intergenic
1159273569 18:66186737-66186759 GGCCGGTGCTTCATCTTCCTAGG + Intergenic
1166003046 19:39889654-39889676 GGCCACCGCTTCGACTTCATGGG - Exonic
1166005833 19:39905906-39905928 GGCCACCGCTTCGACTTCATGGG - Exonic
1166007085 19:39915363-39915385 GGCCGGCGCTTCGACTTCATGGG - Exonic
1166008522 19:39924561-39924583 GGCCGTCGCTACGACATGATGGG - Exonic
941987337 2:171522441-171522463 GACCGGGGCGTCGACTTCTTGGG - Exonic
946416324 2:219541803-219541825 GGCCGGCCCCAGGACTTCATCGG - Exonic
1168925082 20:1572539-1572561 GGACGGCGTTTCTACTTCCTGGG + Intronic
1168928959 20:1605567-1605589 GGACGGCGTTTCTACTTCCTGGG + Intronic
1007321754 6:41032928-41032950 TGCCAGCTCTTCGACTTCAATGG - Exonic
1036218573 8:6901536-6901558 GGCGGGGGCTTCCACGTCATAGG + Intergenic
1049673037 8:143878152-143878174 GGCCGGCGCCTCCTCTTCACCGG + Intronic