ID: 1166014681

View in Genome Browser
Species Human (GRCh38)
Location 19:39971173-39971195
Sequence AAGCCGGCCTCTGTGTGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166014681_1166014688 6 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014688 19:39971202-39971224 TATGGAGGAGATAGGCATCTTGG 0: 1
1: 0
2: 0
3: 7
4: 123
1166014681_1166014693 30 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014693 19:39971226-39971248 GGAGAAGGCTCAGGTACAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 230
1166014681_1166014687 -2 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014687 19:39971194-39971216 TTGGTCACTATGGAGGAGATAGG 0: 1
1: 0
2: 1
3: 6
4: 147
1166014681_1166014690 15 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014690 19:39971211-39971233 GATAGGCATCTTGGTGGAGAAGG 0: 1
1: 1
2: 2
3: 20
4: 213
1166014681_1166014692 29 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014692 19:39971225-39971247 TGGAGAAGGCTCAGGTACAGTGG 0: 1
1: 0
2: 3
3: 25
4: 331
1166014681_1166014691 21 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014691 19:39971217-39971239 CATCTTGGTGGAGAAGGCTCAGG 0: 1
1: 0
2: 0
3: 15
4: 214
1166014681_1166014685 -9 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014685 19:39971187-39971209 GGCCGGCTTGGTCACTATGGAGG 0: 1
1: 0
2: 0
3: 5
4: 61
1166014681_1166014689 9 Left 1166014681 19:39971173-39971195 CCAGGCCACACAGAGGCCGGCTT 0: 1
1: 0
2: 1
3: 15
4: 168
Right 1166014689 19:39971205-39971227 GGAGGAGATAGGCATCTTGGTGG 0: 1
1: 0
2: 0
3: 20
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166014681 Original CRISPR AAGCCGGCCTCTGTGTGGCC TGG (reversed) Exonic
900195948 1:1375471-1375493 AATCCGGCCCCTGGGTGGTCCGG - Intronic
902718747 1:18290479-18290501 AAGGTGGCCTCTGTGAGGACGGG - Intronic
903121129 1:21217701-21217723 AAGCCCGCCTCTATGTGGCAAGG + Intronic
904468491 1:30721809-30721831 AAGCCGCACTCTGTGTGTTCAGG - Intronic
906157605 1:43622994-43623016 AAGCCAGGCTCTGTGGGCCCAGG - Exonic
912722300 1:112030471-112030493 AAGATGACGTCTGTGTGGCCTGG + Intergenic
913958815 1:143323972-143323994 ATGCCGGCCACTGGGTGGCAGGG + Intergenic
914053132 1:144149352-144149374 ATGCCGGCCACTGGGTGGCAGGG + Intergenic
914126065 1:144817189-144817211 ATGCCGGCCACTGGGTGGCAGGG - Intergenic
915133758 1:153714951-153714973 GAGTCGGCCTCTGGGTGGCGGGG + Intergenic
919798194 1:201333975-201333997 AAGATGGCCTATCTGTGGCCTGG + Intergenic
922422239 1:225467786-225467808 GAGCCGCCCTTTCTGTGGCCGGG + Intergenic
922726543 1:227925519-227925541 ATGCTGGCCTCTCTGTGCCCAGG - Exonic
923517685 1:234711144-234711166 AAGACTGGCTCTGTGTGGACTGG - Intergenic
924646461 1:245881963-245881985 CAGCAGGCCCCTGTGCGGCCTGG - Intronic
1063205589 10:3827455-3827477 ACGCCTGCCTCTATGTGGACAGG - Intergenic
1064021552 10:11813319-11813341 AGGCCCAGCTCTGTGTGGCCTGG + Intergenic
1064328898 10:14375674-14375696 AAGCCGACCTCTTTCTTGCCTGG + Intronic
1067215134 10:44294936-44294958 AAGGATGCCTCTGTGGGGCCTGG + Intergenic
1069758044 10:70785700-70785722 AAGCCGACCCCTGTGTGGTGGGG - Intergenic
1069909045 10:71748788-71748810 GAGCCGCCCTCTGAGTTGCCCGG - Exonic
1070284933 10:75075999-75076021 GATCCGGCCTCTGGGTGGGCAGG - Intergenic
1070862336 10:79683245-79683267 AGCTCGGGCTCTGTGTGGCCAGG + Intergenic
1075337175 10:121616976-121616998 AACCTGGCCTCTGTGTCCCCTGG - Intergenic
1076532417 10:131153861-131153883 GAGCTGGGCTCTTTGTGGCCTGG - Intronic
1077018936 11:408976-408998 AATAAGGCCTCTGTGTGGCTTGG + Intronic
1077173647 11:1179207-1179229 AAGTAGGCCTGTGTGTGTCCTGG + Intronic
1077186769 11:1238986-1239008 ACGCGGGCCTGTGTGTGTCCTGG + Exonic
1077247116 11:1545067-1545089 TAGCCAGCCTCTGTGGGGGCAGG - Intergenic
1084432020 11:69116449-69116471 ACCCCGGCCTCTGTCTGCCCTGG + Intergenic
1085792478 11:79507954-79507976 AACCGGGCCTCTGTGTGTACTGG - Intergenic
1086450998 11:86916743-86916765 AAGCTGGCCTCTTGGTGGACTGG - Intronic
1090664505 11:128905628-128905650 AAGCAGGCCTCTGCAGGGCCAGG + Exonic
1091274773 11:134342696-134342718 AAGCCGATCTCTCTGCGGCCCGG + Intronic
1091447021 12:549726-549748 AAGCAGGAGGCTGTGTGGCCTGG - Intronic
1091750483 12:3018867-3018889 AAGCAGACCTCTGGCTGGCCTGG + Intronic
1096718744 12:53506041-53506063 CAGCCGGCCACTGTGTGTCATGG + Exonic
1097778015 12:63669658-63669680 AAGCCTGGCTCATTGTGGCCAGG + Intergenic
1102046257 12:109832197-109832219 GAGCGGGCCTGTGTGGGGCCCGG - Intronic
1102402300 12:112640023-112640045 AAGCAGGGCTCTGGCTGGCCAGG + Intronic
1103228147 12:119305529-119305551 AAGCCATCCTCAGTGTGGGCAGG + Intergenic
1105243636 13:18628782-18628804 AGGCCGGCCTCTGTCCGGCCCGG + Intergenic
1107223223 13:38012294-38012316 ATGCTGGGCTGTGTGTGGCCAGG - Intergenic
1107833744 13:44397195-44397217 AAGCCGGGCTCACTGTGGGCTGG + Intronic
1114439082 14:22731791-22731813 AATCCCGCCTCTGTTTGGGCTGG - Intergenic
1117721427 14:58632198-58632220 AACCCAGCCTCTCTGAGGCCAGG - Intergenic
1118440131 14:65804551-65804573 AAGGGGGCCCCTGTGTGGTCCGG + Intergenic
1119519507 14:75275784-75275806 AAGCCTTCTTCTGTGTTGCCTGG + Intergenic
1121581831 14:95037569-95037591 AAGCCGGCCTTTGTTTGGCCTGG + Intergenic
1122238993 14:100349480-100349502 GAGCCTTCCACTGTGTGGCCCGG - Intronic
1122239002 14:100349512-100349534 CGGCCGTCCGCTGTGTGGCCTGG - Intronic
1123422704 15:20145005-20145027 ATGCCGGCCACTGGGTGGCAGGG + Intergenic
1123495187 15:20816929-20816951 AAGGGGGGTTCTGTGTGGCCAGG + Intergenic
1123531930 15:21151545-21151567 ATGCCGGCCACTGGGTGGCAGGG + Intergenic
1123545080 15:21331687-21331709 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1123551679 15:21386022-21386044 AAGGGGGGTTCTGTGTGGCCAGG + Intergenic
1123924195 15:25092124-25092146 TAACCCGCCTCTGTGTGGCCAGG + Intergenic
1124340595 15:28886992-28887014 CAGCGGGCCTCGGTGTGCCCAGG + Intronic
1124710322 15:32004921-32004943 AAGTCAGCCTCTGTCTGGCCAGG + Intergenic
1125607402 15:40948863-40948885 AAGCCGACCTCTTTGTCGTCTGG + Intergenic
1128099866 15:64989820-64989842 AGGCCGGCCTCTGAGGGGGCGGG + Exonic
1130639896 15:85662524-85662546 GAGCTGGCTTCTGTGTGGCTGGG + Intronic
1202953426 15_KI270727v1_random:58958-58980 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1202960021 15_KI270727v1_random:113264-113286 AAGGGGGGTTCTGTGTGGCCAGG + Intergenic
1132519180 16:379558-379580 AAGCCGGCCTCTGCGGGGGCAGG + Intronic
1132847154 16:2005907-2005929 AAGGCAGCCTCTCTGAGGCCAGG + Intronic
1132854073 16:2037046-2037068 AAGGGGGCCTCTGTCGGGCCTGG - Intronic
1133225600 16:4338927-4338949 CACCAGGCCTCTGAGTGGCCAGG + Exonic
1134091729 16:11395188-11395210 ATGCCTGCCTCTGTGTAGCCTGG + Intronic
1137663643 16:50234022-50234044 ACACCAGCTTCTGTGTGGCCTGG + Intronic
1137671945 16:50284222-50284244 AAGCCGGGCACCGTGAGGCCTGG - Intronic
1138035335 16:53599607-53599629 AAGCTGGTATCTGTGTGGCAAGG + Intronic
1140281208 16:73556798-73556820 AAGAAGGCCTCAGTGAGGCCGGG + Intergenic
1141700593 16:85640351-85640373 AAGCCGGGCTATGGGTGGCTGGG - Intronic
1141844321 16:86596883-86596905 GATCCAGCCTATGTGTGGCCTGG + Intergenic
1142147636 16:88499171-88499193 GAGGCGGCTTCTGTATGGCCAGG - Intronic
1142181647 16:88674102-88674124 CAGCGGGCCTCTGGGTGACCGGG - Intergenic
1143018378 17:3903867-3903889 AGGCCCCCCTCTGTCTGGCCTGG + Intronic
1145216382 17:21055730-21055752 AACCCTGCCTCTATGTGGCCAGG + Intergenic
1145272538 17:21412539-21412561 ACGCCGGCGTCTGAGTGCCCCGG + Intronic
1145282026 17:21475150-21475172 AAGCTGGCCTCTGTGGGGAGAGG + Intergenic
1145310748 17:21700002-21700024 ACGCCGGCGTCTGAGTGCCCCGG + Intronic
1146438954 17:32877011-32877033 GAGGCGGCCTCTGTCCGGCCCGG - Exonic
1146646500 17:34580321-34580343 GAGCCGGCCTGTGTGGAGCCTGG + Intergenic
1148110916 17:45144351-45144373 AAACAGGCCTCTGTGTGGAGGGG + Intergenic
1148866076 17:50629369-50629391 CAGCAGCCCTCTCTGTGGCCTGG + Intergenic
1150434601 17:65144135-65144157 TGGCTGGACTCTGTGTGGCCAGG + Intronic
1151371664 17:73650511-73650533 AAGTCTGCCTCTGGGTGGCTGGG + Intergenic
1153792233 18:8589035-8589057 AAGTCCGCCTCTGTGCAGCCAGG - Intergenic
1154445306 18:14431103-14431125 GGGCCGGCCTCTGTCCGGCCCGG - Intergenic
1160514569 18:79471294-79471316 AAGGCGGCGTCCGCGTGGCCTGG + Intronic
1161060662 19:2213250-2213272 TGGCCGGCCTCTGCGTGGCTGGG + Intronic
1161486234 19:4537332-4537354 AAGGCAGCCCCAGTGTGGCCAGG + Exonic
1164704984 19:30313443-30313465 AAACAGGGCTGTGTGTGGCCAGG - Intronic
1165346198 19:35249982-35250004 CAAGGGGCCTCTGTGTGGCCTGG - Intronic
1166014681 19:39971173-39971195 AAGCCGGCCTCTGTGTGGCCTGG - Exonic
1167045130 19:47045336-47045358 ACTCGGGCCTCGGTGTGGCCGGG - Exonic
1167259786 19:48451871-48451893 AAGCTGGGCCCTGTGTGACCTGG - Intronic
1167377236 19:49118782-49118804 TGGGCGGCCTCTGTGTGGGCGGG + Exonic
1168334187 19:55587492-55587514 AAGCCGGTCTCGGAGTGGGCGGG + Intergenic
1202692527 1_KI270712v1_random:101775-101797 ATGCCGGCCACTGGGTGGCAGGG + Intergenic
927312452 2:21646693-21646715 AGGGGAGCCTCTGTGTGGCCTGG - Intergenic
929079284 2:38106478-38106500 TAGCCAGCCTCTGTGTGAGCTGG + Intronic
932085239 2:68751856-68751878 AAGCAGGCCTGTGGCTGGCCAGG - Intronic
932894500 2:75626030-75626052 AAGGTGACCTCTGTGTGGCTGGG - Intergenic
933953876 2:87352196-87352218 ATGCCGGCCACTGGGTGGCAGGG - Intergenic
934238076 2:90248442-90248464 ATGCCGGCCACTGGGTGGCAGGG - Intergenic
934275123 2:91568294-91568316 ATGCCGGCCACTGGGTGGCAGGG + Intergenic
937014967 2:118596852-118596874 AAACCAGCCACTCTGTGGCCTGG + Intergenic
938077264 2:128346418-128346440 AAGCCGGCCCCTGAGGTGCCAGG + Intergenic
941666303 2:168247112-168247134 AAGCCGGCCTCTCTGCCTCCAGG + Intronic
942710865 2:178834320-178834342 ACGCAGGCCTCTATGTGGCTCGG - Exonic
946415144 2:219536522-219536544 GAGCCGGCCTCTGAGGGCCCTGG + Intronic
948821901 2:240554167-240554189 AAGGCGTCCTCTGGTTGGCCAGG - Intronic
948916369 2:241036669-241036691 AGGTCGGCCTCTGGGTGCCCGGG - Intronic
949035096 2:241812561-241812583 CAGCCGTGCTCAGTGTGGCCAGG - Intronic
1169145735 20:3251203-3251225 ATGCAGGCCTCTGTGTGACCAGG + Exonic
1169707647 20:8523880-8523902 ATGCAGGCCTCTGGGTGGCATGG - Intronic
1171486312 20:25489037-25489059 AAGGCCGCCTCTGTGTGTCCAGG - Intronic
1172699243 20:36842897-36842919 AAGAAGGCCTCTGTGGGCCCTGG + Intronic
1173022502 20:39278767-39278789 AAGAGAGACTCTGTGTGGCCAGG + Intergenic
1174097043 20:48097756-48097778 AAGCCAGCCTCTCTGTGCACTGG + Intergenic
1174552604 20:51372739-51372761 GAGATGGCCTCTGTGTGGCCCGG - Intergenic
1175769756 20:61616281-61616303 CAGCCAGCCTCTGTGTGGGGCGG + Intronic
1176450682 21:6858760-6858782 GGGCCGGCCTCTGTCCGGCCCGG + Intergenic
1176828852 21:13723778-13723800 GGGCCGGCCTCTGTCCGGCCCGG + Intergenic
1181151065 22:20883874-20883896 AAACAGGGCTCTGAGTGGCCAGG - Intronic
1182853297 22:33495116-33495138 AAGGAGGCCTCTGTGTGTCCGGG - Intronic
1184220566 22:43097174-43097196 AAGACGGGCTCTGTGCTGCCTGG - Intergenic
1184495796 22:44840663-44840685 TGGACCGCCTCTGTGTGGCCTGG + Intronic
1184881188 22:47305042-47305064 CATCCAGGCTCTGTGTGGCCAGG + Intergenic
1185250974 22:49801547-49801569 AAACCTGCCTCTGTGTGAACGGG - Intronic
953563767 3:44014094-44014116 GGGCCGGGCTCTGTGCGGCCTGG - Intergenic
954615247 3:51966209-51966231 AAGCCAGCCTCCTCGTGGCCTGG + Intronic
969510208 4:7613352-7613374 CAGCGGGGCTCTGCGTGGCCAGG + Intronic
985303495 4:188514190-188514212 AAGCAGGAAGCTGTGTGGCCAGG + Intergenic
985856001 5:2427990-2428012 AAGCAGTCATCTGTGTGGCCTGG + Intergenic
985994431 5:3589805-3589827 GAGCGCACCTCTGTGTGGCCAGG + Intergenic
986244345 5:5991918-5991940 AAGCGGGCACCTGTGTGGCATGG + Intergenic
990450373 5:55927624-55927646 GAGCCTGCCTCTCTGTTGCCAGG + Intergenic
990796489 5:59547827-59547849 GACCAGGCCTCTGTGTGTCCCGG - Intronic
997399450 5:133591219-133591241 AACCCGGCCTGTCTGTGGCTGGG - Intronic
997459664 5:134043350-134043372 AGCCCTGCCTCTGTGTGACCTGG - Intergenic
997519350 5:134512639-134512661 GGGCTGCCCTCTGTGTGGCCTGG - Intergenic
1000337304 5:160251474-160251496 CCGCTGGCCTCTGTGTGCCCAGG + Intergenic
1002586602 5:180252685-180252707 GAGACGGCCACTGGGTGGCCTGG + Intronic
1004427034 6:15513608-15513630 GGGACAGCCTCTGTGTGGCCTGG - Intronic
1005509533 6:26500215-26500237 AAGCCTGCCTCCAGGTGGCCTGG - Intergenic
1006096003 6:31657227-31657249 AAGATGGGCTCTGTGTGCCCCGG + Exonic
1006620588 6:35361168-35361190 GAGCCAGACTCTGTGTGGCATGG + Intronic
1006964938 6:37973725-37973747 AAGAAGGCCTGTGTATGGCCTGG + Intronic
1018675811 6:166221481-166221503 AAGCTGGGCTCTGTGGGGCCTGG - Intergenic
1019017521 6:168890732-168890754 CAGCCGGGCTCTCTGTGTCCTGG - Intergenic
1019282474 7:207445-207467 ATGCCGTCCTCTGTGGGGCCGGG + Intronic
1020139943 7:5606655-5606677 AGGCCGGCCTGTGTGTGTCTTGG + Exonic
1024565568 7:50677114-50677136 AAGCAGGGCCCTGTGTGCCCAGG + Intronic
1029255682 7:99267899-99267921 AAGCCTGCCTCTGTGCCGCCTGG + Intergenic
1029590654 7:101504649-101504671 ATGCCAGCCTCTGGGTGCCCTGG - Intronic
1034577285 7:152011389-152011411 AGGCCAGCCTCTGTTTTGCCAGG - Intronic
1037806008 8:22058215-22058237 CTGCCGGCCTCTCTGTGGTCAGG + Intronic
1037882842 8:22581287-22581309 AAGCCAGCCTCTGTGTTTCTTGG + Intronic
1038807353 8:30807033-30807055 AAGCCAGCCTCTTAGTGGACAGG - Intronic
1048964401 8:139604847-139604869 CAGCCTGGCTTTGTGTGGCCAGG + Intronic
1049306731 8:141907972-141907994 CAGGTGGCCTGTGTGTGGCCGGG + Intergenic
1049363159 8:142223932-142223954 AAGCCCTCCCCTGGGTGGCCAGG - Intronic
1049389250 8:142359642-142359664 CAGGCGGGCTCTGGGTGGCCTGG - Intronic
1053275394 9:36779849-36779871 CTGCAGGGCTCTGTGTGGCCTGG - Intergenic
1053690990 9:40587475-40587497 ATGCCGGCCACTGGGTGGCAGGG - Intergenic
1054434632 9:65199266-65199288 ATGCCGGCCACTGGGTGGCAGGG - Intergenic
1054495757 9:65822415-65822437 ATGCCGGCCACTGGGTGGCAGGG + Intergenic
1056756599 9:89385720-89385742 AAGAGGGCCCCTGTCTGGCCGGG - Intronic
1057271871 9:93656117-93656139 CAGCCCGCCTGTGGGTGGCCTGG + Intronic
1061093258 9:128438971-128438993 AAGCCCGACTCTCTGGGGCCAGG - Intergenic
1061131960 9:128713391-128713413 AGGCTGGCCTTTGTGTGGTCAGG + Intronic
1061156113 9:128862770-128862792 CATCGGGCCTATGTGTGGCCGGG + Intronic
1061226566 9:129284068-129284090 AAGCCGCACTCAGTGTGGACAGG - Intergenic
1061987287 9:134136793-134136815 AGGCCGACCTCTGTTTGGTCCGG - Intronic
1062178747 9:135179285-135179307 CAGCTGGCCCCCGTGTGGCCTGG - Intergenic
1062595473 9:137297147-137297169 AGGCAGGCCCCTTTGTGGCCAGG - Intergenic
1203518500 Un_GL000213v1:25757-25779 GGGCCGGCCTCTGTCCGGCCCGG - Intergenic
1189273039 X:39765112-39765134 AAGCAATCCTCTGTGAGGCCAGG + Intergenic
1192202030 X:69072581-69072603 CAGCCAGCCTTTGTGTGTCCTGG - Intergenic
1199745427 X:150769399-150769421 AGGCCAGCATCTGTGTGGGCAGG - Intronic
1201189693 Y:11436172-11436194 ATGCCGGCCACTGGGTGGCAGGG - Intergenic
1202583955 Y:26405797-26405819 ATGCCGGCCACTGGGTGGCAGGG + Intergenic