ID: 1166014777

View in Genome Browser
Species Human (GRCh38)
Location 19:39971571-39971593
Sequence CCGTGCGGCCGAGTGATCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166014767_1166014777 24 Left 1166014767 19:39971524-39971546 CCCGGCGTTGGGATTGGGTCAGG No data
Right 1166014777 19:39971571-39971593 CCGTGCGGCCGAGTGATCCCCGG No data
1166014769_1166014777 23 Left 1166014769 19:39971525-39971547 CCGGCGTTGGGATTGGGTCAGGC No data
Right 1166014777 19:39971571-39971593 CCGTGCGGCCGAGTGATCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166014777 Original CRISPR CCGTGCGGCCGAGTGATCCC CGG Intronic